ID: 1158485605

View in Genome Browser
Species Human (GRCh38)
Location 18:57863216-57863238
Sequence GTCAATAAGTCCCATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158485605_1158485606 7 Left 1158485605 18:57863216-57863238 CCTGCTTCATGGGACTTATTGAC No data
Right 1158485606 18:57863246-57863268 AGATGATCAGATGAGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158485605 Original CRISPR GTCAATAAGTCCCATGAAGC AGG (reversed) Intergenic
No off target data available for this crispr