ID: 1158486041

View in Genome Browser
Species Human (GRCh38)
Location 18:57866868-57866890
Sequence CTTATGTAACCTCTGCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158486039_1158486041 8 Left 1158486039 18:57866837-57866859 CCCAGGCTGGAGTGCAGTGGCAT 0: 28224
1: 118228
2: 203662
3: 203067
4: 135168
Right 1158486041 18:57866868-57866890 CTTATGTAACCTCTGCCTCCCGG No data
1158486040_1158486041 7 Left 1158486040 18:57866838-57866860 CCAGGCTGGAGTGCAGTGGCATG 0: 28465
1: 91631
2: 178015
3: 198511
4: 164335
Right 1158486041 18:57866868-57866890 CTTATGTAACCTCTGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158486041 Original CRISPR CTTATGTAACCTCTGCCTCC CGG Intergenic
No off target data available for this crispr