ID: 1158490768

View in Genome Browser
Species Human (GRCh38)
Location 18:57907491-57907513
Sequence ATGGAGAAAAGAAATTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158490755_1158490768 29 Left 1158490755 18:57907439-57907461 CCACTCTGCTGTGGAGGTGGAGG No data
Right 1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG No data
1158490765_1158490768 -7 Left 1158490765 18:57907475-57907497 CCCTGAGGATGGAGGCATGGAGA No data
Right 1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG No data
1158490762_1158490768 0 Left 1158490762 18:57907468-57907490 CCCTGAGCCCTGAGGATGGAGGC No data
Right 1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG No data
1158490754_1158490768 30 Left 1158490754 18:57907438-57907460 CCCACTCTGCTGTGGAGGTGGAG No data
Right 1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG No data
1158490763_1158490768 -1 Left 1158490763 18:57907469-57907491 CCTGAGCCCTGAGGATGGAGGCA No data
Right 1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG No data
1158490766_1158490768 -8 Left 1158490766 18:57907476-57907498 CCTGAGGATGGAGGCATGGAGAA No data
Right 1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158490768 Original CRISPR ATGGAGAAAAGAAATTAGGA TGG Intergenic
No off target data available for this crispr