ID: 1158494287

View in Genome Browser
Species Human (GRCh38)
Location 18:57940183-57940205
Sequence CAACGTAAGGTGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158494287_1158494293 8 Left 1158494287 18:57940183-57940205 CCATCCACCTTCACCTTACGTTG No data
Right 1158494293 18:57940214-57940236 ATCAGTTTGAATTTCTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158494287 Original CRISPR CAACGTAAGGTGAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr