ID: 1158495904

View in Genome Browser
Species Human (GRCh38)
Location 18:57954931-57954953
Sequence CTGAGTTGGGGCAAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158495892_1158495904 25 Left 1158495892 18:57954883-57954905 CCGACCCCGCAGGGGGCTCTGGA No data
Right 1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG No data
1158495895_1158495904 19 Left 1158495895 18:57954889-57954911 CCGCAGGGGGCTCTGGAGCTGAG No data
Right 1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG No data
1158495894_1158495904 20 Left 1158495894 18:57954888-57954910 CCCGCAGGGGGCTCTGGAGCTGA No data
Right 1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG No data
1158495893_1158495904 21 Left 1158495893 18:57954887-57954909 CCCCGCAGGGGGCTCTGGAGCTG No data
Right 1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158495904 Original CRISPR CTGAGTTGGGGCAAGGGGAC AGG Intergenic
No off target data available for this crispr