ID: 1158496420

View in Genome Browser
Species Human (GRCh38)
Location 18:57959194-57959216
Sequence GAGTATAGCTGAGAGCTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158496420_1158496421 -5 Left 1158496420 18:57959194-57959216 CCAAATAGCTCTCAGCTATACTC No data
Right 1158496421 18:57959212-57959234 TACTCCAAACCCATGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158496420 Original CRISPR GAGTATAGCTGAGAGCTATT TGG (reversed) Intergenic
No off target data available for this crispr