ID: 1158497524

View in Genome Browser
Species Human (GRCh38)
Location 18:57969992-57970014
Sequence ATGTGGGTGTGGAGTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158497524_1158497528 -2 Left 1158497524 18:57969992-57970014 CCTTCATCACTCCACACCCACAT No data
Right 1158497528 18:57970013-57970035 ATCCTCCCACCACAACCACAAGG No data
1158497524_1158497529 -1 Left 1158497524 18:57969992-57970014 CCTTCATCACTCCACACCCACAT No data
Right 1158497529 18:57970014-57970036 TCCTCCCACCACAACCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158497524 Original CRISPR ATGTGGGTGTGGAGTGATGA AGG (reversed) Intergenic
No off target data available for this crispr