ID: 1158501606

View in Genome Browser
Species Human (GRCh38)
Location 18:58007395-58007417
Sequence TGTAAGTTCTTTAAGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158501600_1158501606 23 Left 1158501600 18:58007349-58007371 CCTTTCTTAGCATTTATAATATG No data
Right 1158501606 18:58007395-58007417 TGTAAGTTCTTTAAGGGAAGAGG No data
1158501603_1158501606 -2 Left 1158501603 18:58007374-58007396 CCATGTATTTTAGTACTGGACTG No data
Right 1158501606 18:58007395-58007417 TGTAAGTTCTTTAAGGGAAGAGG No data
1158501599_1158501606 28 Left 1158501599 18:58007344-58007366 CCTTTCCTTTCTTAGCATTTATA No data
Right 1158501606 18:58007395-58007417 TGTAAGTTCTTTAAGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158501606 Original CRISPR TGTAAGTTCTTTAAGGGAAG AGG Intergenic
No off target data available for this crispr