ID: 1158508535

View in Genome Browser
Species Human (GRCh38)
Location 18:58068813-58068835
Sequence AGGAGCATGAAGGACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158508535_1158508541 -2 Left 1158508535 18:58068813-58068835 CCCTCCAGGTCCTTCATGCTCCT 0: 1
1: 0
2: 4
3: 32
4: 287
Right 1158508541 18:58068834-58068856 CTTTTGGAAAGAAGCGTTCCTGG 0: 1
1: 0
2: 10
3: 32
4: 147
1158508535_1158508542 11 Left 1158508535 18:58068813-58068835 CCCTCCAGGTCCTTCATGCTCCT 0: 1
1: 0
2: 4
3: 32
4: 287
Right 1158508542 18:58068847-58068869 GCGTTCCTGGCCAGACACAGTGG 0: 1
1: 6
2: 18
3: 160
4: 978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158508535 Original CRISPR AGGAGCATGAAGGACCTGGA GGG (reversed) Intronic
900652131 1:3734890-3734912 AGGAGCCGGAAGGAGCTGGAAGG - Exonic
901226090 1:7613757-7613779 GGGAGCAGGCGGGACCTGGAGGG + Intronic
901226113 1:7613834-7613856 GGGAGCAAGTAGGACCTGGAGGG + Intronic
902347297 1:15827774-15827796 AGGAGGCTGAGGCACCTGGAAGG + Intergenic
904341333 1:29836899-29836921 AGGTTCAGGAAGGAGCTGGAGGG - Intergenic
905310110 1:37043167-37043189 AGGAGCATGAAGGAGCAGCTGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905690247 1:39937521-39937543 AGGAGCATCAAGGAACTGCTAGG - Intergenic
906495911 1:46303687-46303709 AGGATCAAGAAGGACTTGTAAGG - Exonic
906648845 1:47495978-47496000 AAGAGCAGGCAGGATCTGGATGG - Intergenic
906824176 1:48961165-48961187 AGGAACATGGAGGAACTGCAGGG + Intronic
907068999 1:51518143-51518165 AGGAGCAGGAAGGAACTGGCAGG + Intronic
909332100 1:74425796-74425818 AGAAGCAAGAAGGAGCTAGAGGG + Intronic
911804345 1:102186555-102186577 AGATGCATGAAGGACATGAAGGG - Intergenic
913447882 1:118969346-118969368 TGGACCATGAAAGACCTGAAGGG + Intronic
914360613 1:146932828-146932850 AGGATCAAGAAGGTCCGGGAAGG - Intergenic
914491973 1:148157811-148157833 AGGATCAAGAAGGTCCGGGAAGG + Intergenic
914510849 1:148330585-148330607 AGGAGCAGGAAGGCCCAGGCAGG - Intergenic
915073714 1:153292678-153292700 AGGAGCATGAAGAAACAGGCAGG + Intergenic
915848654 1:159297361-159297383 CTGAGGATGAAGAACCTGGAAGG - Intronic
916686734 1:167153980-167154002 AGTAGCATCAAGGAAATGGAGGG + Intergenic
917033749 1:170723226-170723248 TGCAGCATGAAGGGCCTGGGTGG - Intronic
917465740 1:175274337-175274359 ATGAGCATGAAGCACCAGAAAGG - Intergenic
918150413 1:181793735-181793757 AGGAGCATGCGGGATCTGGGAGG + Exonic
919438349 1:197592547-197592569 AGGATCATGAAGGAACTAGACGG + Intronic
919974987 1:202604462-202604484 ATGAACATGAAGGACATGAAAGG - Exonic
920030684 1:203035724-203035746 TGGAGCCAGAAGGAGCTGGAAGG + Intronic
920384555 1:205560927-205560949 AGAAACATGATGAACCTGGAAGG + Intergenic
920497908 1:206468483-206468505 AGGAGCCTGGAGGTCCAGGATGG - Intergenic
920679617 1:208062560-208062582 AAGAGCATTCAGGGCCTGGATGG - Intronic
922580755 1:226696031-226696053 AGTAGCAGGAAGGAACTGAATGG - Intronic
922719640 1:227893656-227893678 AGGAGAATGCAGGAGCTGGGAGG + Intergenic
922767570 1:228163850-228163872 TGGAGGATGAGGGACCTGGTTGG - Intergenic
1063343789 10:5293034-5293056 AGCAGCATGAAGGCCTTGGCTGG - Intergenic
1064611657 10:17109649-17109671 AGGAGCATGAGGCATCTGGGTGG + Exonic
1064939372 10:20715315-20715337 AGCAGAATGAAGGACAGGGAGGG + Intergenic
1065832901 10:29631150-29631172 AGGGGCATGAAAGACCCTGAAGG + Intronic
1065843839 10:29728714-29728736 AGCAGCATGGAGGAGCTGAACGG + Intronic
1067793900 10:49307116-49307138 AGGAGCAGGAAAGATCTGGAAGG - Intronic
1069901710 10:71710385-71710407 AGGAGCAGGAGGGCCCAGGATGG - Intronic
1069932410 10:71891647-71891669 CGCAGCATGCAGGCCCTGGAGGG + Intergenic
1071506818 10:86237402-86237424 AAAAGCATGTAGCACCTGGATGG + Intronic
1071573314 10:86709734-86709756 AGGACCATGAGGGTCTTGGAGGG - Intronic
1074179077 10:111041922-111041944 AGAAATATGAAGAACCTGGAAGG + Intergenic
1075719353 10:124575879-124575901 AGGGGCATGAGGTGCCTGGACGG + Intronic
1075849610 10:125576118-125576140 GGGAGCAGGAAGGACCCAGAGGG - Intergenic
1076794167 10:132790697-132790719 AGGGGCTGGGAGGACCTGGATGG + Intergenic
1077022190 11:422230-422252 AGGAGCATGAAAGACTTGCAGGG + Intronic
1077215351 11:1393190-1393212 TGGAGCATGCAGGTCCAGGAGGG + Intronic
1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG + Exonic
1078063311 11:8061943-8061965 AGGAGCAGGAAGGAACTCCAGGG - Intronic
1080643670 11:34173293-34173315 AGCAGCATGAAGGGCCTGTGGGG + Exonic
1081740644 11:45437431-45437453 TGCAGCAGAAAGGACCTGGAAGG + Intergenic
1082989785 11:59197428-59197450 GGAAGCATGAAGGAGATGGAGGG + Intronic
1085459786 11:76686670-76686692 AGGAGCACGAAGGAAGTGAAAGG - Intergenic
1085505846 11:77058327-77058349 AGGAGCTTGCAGGGCCTGGCAGG + Intergenic
1087177821 11:95111228-95111250 AGGAGCAGGAAGGCACTGAACGG - Intronic
1089084216 11:115803169-115803191 AGGAGAAGGAAGGATGTGGATGG - Intergenic
1089294980 11:117461954-117461976 ATGAACATGACAGACCTGGAAGG + Intronic
1089323459 11:117641855-117641877 AGCACCATGAAGGGCCTGGCTGG - Intronic
1090387992 11:126367528-126367550 ACAAGCATTCAGGACCTGGAAGG - Intronic
1090450123 11:126798658-126798680 AGGACCTGGAAGAACCTGGAAGG - Intronic
1090958474 11:131535037-131535059 AGCAGCATCAAGGACCTGAGAGG - Intronic
1091488779 12:915217-915239 AGGGGCAGGAAAGGCCTGGAGGG + Intronic
1091840694 12:3618519-3618541 AGGAGGAGGAAGGGCCTGGCAGG - Intronic
1094200299 12:27788098-27788120 AGGAGACAAAAGGACCTGGATGG + Intronic
1096747838 12:53739922-53739944 AGAGGCATGATGGACCAGGAGGG + Intergenic
1097167565 12:57093849-57093871 AAGAGGATGAAGGAGCAGGAAGG + Intronic
1098730298 12:74027887-74027909 AACAGCATGAAGGACATGTATGG + Intergenic
1101721767 12:107356515-107356537 AAGAGCTTGAAACACCTGGAAGG - Intronic
1101789457 12:107913808-107913830 AATAGCAGGAAGGACCTGGAAGG - Intergenic
1101891714 12:108722369-108722391 AGGAGGATGAAGAACAAGGAGGG + Intronic
1103108297 12:118251016-118251038 GGGACCATGAAGGACCTTGTGGG + Intronic
1103367458 12:120393714-120393736 AGGACCCTGAGGGACCTGCAAGG + Intergenic
1103780112 12:123392845-123392867 AGGAGGAAGAAAGATCTGGATGG + Intronic
1103948383 12:124539411-124539433 GTGAGCATGAAGGAGCTGGTGGG - Intronic
1105340017 13:19513884-19513906 AAGAGCATGAAGGTGGTGGAGGG - Intronic
1105670018 13:22602943-22602965 AGGAGCATCAAGGCACTGAAGGG + Intergenic
1106117397 13:26829460-26829482 AGGACCAAGCAGGACCAGGAAGG + Intergenic
1107196806 13:37662007-37662029 AGGATCAAGAAGGAGCTGGAAGG + Intronic
1107820942 13:44285169-44285191 ATGAATATGAAGTACCTGGAGGG - Intergenic
1107986222 13:45778591-45778613 AGGAGAAGCAAGGCCCTGGAAGG - Exonic
1108743334 13:53362189-53362211 AGGAAAAAGAAAGACCTGGAGGG - Intergenic
1108798323 13:54061356-54061378 AGGAGCCTGAAGGAAATGAATGG + Intergenic
1110601743 13:77382726-77382748 AGGAGCATGAAGGAATTTAATGG - Intergenic
1111273655 13:85918484-85918506 ATGAGCAGTAAGGATCTGGAGGG - Intergenic
1113399594 13:109978808-109978830 AGGAGAATTAAGATCCTGGAGGG - Intergenic
1113819382 13:113202060-113202082 AGGAGCCTGAAGCAACTAGAAGG + Intronic
1114642787 14:24235389-24235411 AGAACCATGAAGAAGCTGGATGG - Intronic
1114643750 14:24242114-24242136 TGGAGCAAGTAGGACCTGGAAGG - Intronic
1115252759 14:31366593-31366615 AGTAGCAGGAAGGCCCTGCAGGG - Intronic
1115439479 14:33415689-33415711 AGGACCATGAATGTCTTGGACGG - Intronic
1116081554 14:40180279-40180301 AGGAACATGAAGGACATGAGAGG - Intergenic
1116162106 14:41281151-41281173 AGGCCCATGAAGAAACTGGATGG - Intergenic
1117072332 14:52068573-52068595 GGGAGCAAGAATGACCTGGAGGG - Intronic
1118113668 14:62750708-62750730 AAGAGCATGAAGTACCAGAAAGG + Intronic
1118821751 14:69350480-69350502 AAGAGCATGAAGAAACAGGAGGG + Intronic
1118979157 14:70701973-70701995 AGAGGCAGGAAGGACCTGGAGGG - Intergenic
1121313158 14:92945995-92946017 AGGAGCAGGAAGGACCTTGAAGG - Intronic
1122117729 14:99536074-99536096 AGGTGGATGAGGGATCTGGAAGG + Exonic
1122297768 14:100714792-100714814 GGTAGCATGAAGGACAAGGACGG - Intergenic
1122404266 14:101490575-101490597 TGGGGCATGGAGGACCAGGAGGG + Intergenic
1122875195 14:104660660-104660682 AGGAGCCTGCAGGACCGAGAGGG + Intergenic
1122923957 14:104891394-104891416 AAGCCCATGAGGGACCTGGAAGG + Intronic
1123893891 15:24809286-24809308 AGGAGACTGTCGGACCTGGATGG + Intergenic
1124410770 15:29434699-29434721 AGGAGCATGGATGAGCTGTAAGG - Intronic
1125596684 15:40891767-40891789 AAGAGCATGTAGGACCTCTAAGG - Intergenic
1127501864 15:59561225-59561247 AGGAGGATGTAGGATATGGATGG + Intergenic
1128287037 15:66445828-66445850 AGGAGCATGAAGGAACTTTTTGG + Intronic
1128786638 15:70402441-70402463 AGCAGCCTTGAGGACCTGGAGGG + Intergenic
1129988164 15:79936891-79936913 ATGAGCATGAAGGACCTGGGGGG - Intergenic
1131178419 15:90224436-90224458 AGCAGCATGAAGGAATAGGAAGG + Intronic
1133740006 16:8644231-8644253 GGGTGCAGGCAGGACCTGGAGGG + Intronic
1134771618 16:16814082-16814104 CGGTGCCTGAAGCACCTGGAGGG - Intergenic
1135992947 16:27228724-27228746 AGTACCATGATGGATCTGGAGGG - Intronic
1138370125 16:56520008-56520030 AGGAGCAGGCGGTACCTGGACGG - Exonic
1138586481 16:57973616-57973638 AGGAGCCTGAAGGAGCTGCCAGG + Intergenic
1139531221 16:67543643-67543665 ATGGGCATGAAGGACATGGGAGG - Intronic
1140596136 16:76415678-76415700 AGGAGCATGAAGGAACTGTTGGG - Intronic
1141016307 16:80453506-80453528 AGGAGGGTGAAGGAACAGGATGG + Intergenic
1141183551 16:81771177-81771199 AGCAGAAGGAAGGACCTTGAGGG - Intronic
1142619166 17:1154159-1154181 AGGATCATGAAGGACCTGGGAGG - Intronic
1142755511 17:2014229-2014251 AGCAGCATGAGGGATCTGGAGGG + Intronic
1143151677 17:4810794-4810816 TTGAGAATCAAGGACCTGGATGG - Exonic
1145069241 17:19788861-19788883 AGGGGCAGGAAAGACCGGGAAGG + Intronic
1145280597 17:21464331-21464353 AGGAGCAGGAAGGAGCAGGAGGG + Intergenic
1147057565 17:37846072-37846094 ATGAGCATAAAGGAACTGGGTGG + Intergenic
1147118349 17:38319742-38319764 AGGAGTGTGAAGCACTTGGAGGG + Intronic
1147369515 17:39981748-39981770 AGGGGCAGTAAGGACCTGAAGGG - Intronic
1148748466 17:49931348-49931370 AGGAGAATGGAGGAGCTGGCTGG - Intergenic
1149190941 17:54060998-54061020 AGGAGTAAGGAGGACCTGGTGGG - Intergenic
1149594289 17:57855027-57855049 AGGAGGATGAAGGGCAGGGAGGG + Intergenic
1150248020 17:63690583-63690605 AAGAGCACCAAGCACCTGGAGGG + Intronic
1151480857 17:74369417-74369439 AGGAGGAGGAAGGAACTGGTGGG - Intronic
1152268964 17:79312682-79312704 ATGTGCATGAAGGAGCTGGAGGG - Intronic
1157449227 18:47772905-47772927 TGAAGCAGGAAGGACCTCGAGGG + Intergenic
1158508535 18:58068813-58068835 AGGAGCATGAAGGACCTGGAGGG - Intronic
1158599760 18:58847193-58847215 GGGAGCAGGAAAGGCCTGGAGGG + Intergenic
1158653406 18:59307673-59307695 AGGAGCAAGGAGACCCTGGAAGG - Intronic
1159246463 18:65811541-65811563 AGCAGCAGGAAGCACTTGGAAGG - Intronic
1161404042 19:4081925-4081947 AGGAGCAAGAAGGAGGAGGAGGG - Intergenic
1161896996 19:7089909-7089931 AGAAGAATGAAGGACAAGGAGGG - Intergenic
1162858291 19:13486790-13486812 AGGGGAGAGAAGGACCTGGATGG - Intronic
1163101672 19:15101117-15101139 AGTAGCATTCAGGAGCTGGAGGG - Intergenic
1163827560 19:19532254-19532276 TGGAGCATGAAGGACTTCGATGG - Intronic
1164714515 19:30381584-30381606 TGGAGCATGAGGGACCAGGGAGG + Intronic
1164789673 19:30965409-30965431 AGGAACCTACAGGACCTGGATGG + Intergenic
1165080434 19:33303214-33303236 GGGAGCCTGGAGGACCTGGCCGG + Intergenic
1167411781 19:49348442-49348464 ACTAGCATAAAGGAACTGGAAGG - Intronic
1167534119 19:50038547-50038569 AGGAGCATGGAGGATGTAGAAGG + Intronic
1167761827 19:51454591-51454613 CAGAGCTGGAAGGACCTGGATGG - Intronic
1168105229 19:54162280-54162302 AGGAGCCTGAAGGACGGGGCGGG + Exonic
1168156070 19:54473505-54473527 AGGAGGATGAAGAGCATGGAGGG + Intergenic
926087309 2:10028575-10028597 TGGAGCATGAGGGGCCTGGGGGG - Intergenic
927591853 2:24363448-24363470 AGGATGATGAAGGTCCTGGGCGG - Intergenic
928184923 2:29101699-29101721 AGCAGCATGAAGGACTGTGATGG - Intronic
929931126 2:46256381-46256403 AGGAGCTGGAAGCCCCTGGAGGG - Intergenic
930166744 2:48210577-48210599 AGGAGAATGGAGAACATGGAGGG - Intergenic
931053987 2:58447924-58447946 AGAAGAATGAAGGACAGGGAGGG - Intergenic
931634474 2:64329182-64329204 AGAAGCAGGAAGGTCCAGGACGG - Intergenic
932008102 2:67947830-67947852 AGGAACATGAAGGAACTGTTTGG - Intergenic
932449566 2:71800808-71800830 GGGAGCAGCAAGGGCCTGGATGG - Intergenic
933571863 2:84023288-84023310 AGGTGCAAGAAGGCCTTGGAGGG + Intergenic
933933552 2:87180254-87180276 ATGAGCATGAATGGCCTGGCAGG - Intergenic
935212976 2:100954202-100954224 GAGAGCCTGAAGGACCTGGTTGG + Intronic
935338204 2:102036155-102036177 AGGAGTAAGAATGTCCTGGAGGG - Intergenic
936359559 2:111785190-111785212 ATGAGCATGAATGGCCTGGCAGG + Intronic
937083591 2:119157137-119157159 AGGAGGAGGGGGGACCTGGAAGG - Intronic
938092440 2:128442247-128442269 GGGAGCAAGAAGGAACTGGAGGG + Intergenic
939874125 2:147556964-147556986 AGGAGCCAGAAGGAACAGGATGG + Intergenic
940061067 2:149568781-149568803 GGGAGCATGTAGTACCTAGAAGG + Intergenic
943529657 2:189063228-189063250 TGGAGCCTGGAGGACCTGGACGG + Exonic
946147969 2:217744980-217745002 AGAAGGATGAAGGCCCTGAAGGG - Intronic
946756329 2:222951522-222951544 AAAAGCAGGAAGGACTTGGAGGG - Intergenic
946894617 2:224310643-224310665 CAGAGCATGAAGGTCCTGGCAGG - Intergenic
947567148 2:231201438-231201460 AGGAGGATGAAGAAACTGGAGGG - Intronic
947743163 2:232494188-232494210 AGAAGCCTGAATGGCCTGGAGGG + Intergenic
948289814 2:236816659-236816681 AGGAGCCTGGAGGCCCAGGAGGG - Intergenic
1168990142 20:2087997-2088019 AGGAACATGAAGGATCAAGAAGG - Intergenic
1170021360 20:11840082-11840104 TGGAGCAAGCAGGACATGGAAGG - Intergenic
1170133341 20:13046386-13046408 AGAAGAAAGAAGGACTTGGAAGG - Intronic
1170544430 20:17422973-17422995 AGGAGAATGAAAGACCTAAATGG + Intronic
1170734773 20:19005286-19005308 TGGAGCCTGGAGGAGCTGGAGGG + Intergenic
1170951541 20:20940640-20940662 AGGAGCATGAAAGAACTGTCTGG - Intergenic
1171431855 20:25087923-25087945 AGGGGCATGAAGGAGGTAGAAGG - Intergenic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1175379716 20:58554393-58554415 AGCCTCATGAATGACCTGGATGG + Intergenic
1175937671 20:62521924-62521946 AGGAGCCTGAAGAACCCGGGAGG - Intergenic
1175978415 20:62725192-62725214 AGGAACAGGAAGGGGCTGGAAGG + Intronic
1176171116 20:63696762-63696784 AGGACCATGAGGGCGCTGGAGGG + Exonic
1176734190 21:10527879-10527901 AAGAGCATGAAGGTGGTGGAGGG + Intronic
1179827909 21:43978231-43978253 AGGAGTATTTAGGACCTGGGTGG - Intronic
1180037404 21:45256837-45256859 TGGAGCCACAAGGACCTGGAGGG - Intergenic
1180713539 22:17856401-17856423 AGGAGAATGAAGGGCCAGGGAGG - Intronic
1180901345 22:19375593-19375615 AGGACCCTGAAGGACCAGGCAGG - Intronic
1181785113 22:25221366-25221388 AGCAGCAGTGAGGACCTGGAGGG - Intronic
1182740052 22:32561129-32561151 AGGAGCAGGAAAAACCTGGAGGG - Intronic
1183342863 22:37291581-37291603 TGGAGCAGGAAGGAGCTGGCAGG + Intronic
1183732076 22:39624228-39624250 AGGAGCAAAGAGGACCTGGAGGG - Intronic
1184110915 22:42394336-42394358 AGGATCAATAAGGACATGGAGGG - Intronic
1184201106 22:42970346-42970368 AAAATCATCAAGGACCTGGATGG + Intronic
1184257790 22:43296908-43296930 GGGAGCCTGAAGGTCCTTGAAGG + Intronic
1185092804 22:48785383-48785405 AGGAGCATGAAGGGCCTTTGGGG + Intronic
950178294 3:10892389-10892411 TGGGGCATGAAGGACCGAGATGG - Intronic
951637072 3:24791538-24791560 AGTAGCATGGAGCACCTAGAAGG + Intergenic
951997135 3:28743688-28743710 ATGAACATAAAGGCCCTGGAGGG - Intergenic
954615054 3:51965246-51965268 TGGATCATGAAGGTCCTTGATGG - Intronic
954745818 3:52787045-52787067 AGGGGCATGGCGGACCAGGACGG + Exonic
958867016 3:99512756-99512778 AGGAGCAGAAAGGTCCTGAAAGG + Intergenic
959901567 3:111667433-111667455 GGAAGTATGAATGACCTGGATGG - Intergenic
961616623 3:128187891-128187913 AGAAGTATGAAGGATTTGGAGGG + Intronic
967323858 3:188219720-188219742 AGGAGCATCAAGGACCCACATGG - Intronic
967950278 3:194835140-194835162 AGGAGCAAAAAGGACCGTGAAGG - Intergenic
968226717 3:196977034-196977056 AGGAGTTGGAAGGATCTGGACGG + Intergenic
968936797 4:3615380-3615402 AACAGCAGGAAGGACCTGGGTGG - Intergenic
969963733 4:10973325-10973347 AGGAGCCTGAGGGAGCTCGAGGG - Intergenic
970407749 4:15779369-15779391 AGGAGCATGAGAAAACTGGAAGG - Intronic
973581376 4:52347671-52347693 ATGAGCATGAAGTACCAGAAAGG + Intergenic
974096716 4:57372264-57372286 AGGAGCATGAATGAGCTGTGAGG - Intergenic
975188480 4:71431484-71431506 AAGACCATGGAGGACATGGAGGG + Intronic
975414264 4:74089508-74089530 ATGAGCATGAAGCACCAGAATGG - Intergenic
976596710 4:86901768-86901790 AAGAGCACGAAGGTCATGGAGGG - Intronic
977092381 4:92694188-92694210 AGGAGCAGGAAGCACCTGGTTGG + Intronic
977567982 4:98600775-98600797 TGGATCATGAAGGACCTTAATGG + Intronic
978206305 4:106084233-106084255 AGGAACATAAACGACCTGAAGGG + Intronic
978366134 4:107984767-107984789 GGATGCATGAAGAACCTGGATGG + Intergenic
980494039 4:133569158-133569180 AAGAGCATAAATGACCTAGACGG - Intergenic
982081569 4:151795242-151795264 AGGAACATCAAGGACTTAGAAGG - Intergenic
984097058 4:175447003-175447025 ATGAGCACGAAGTACCAGGAAGG + Intergenic
985750813 5:1673233-1673255 AGGAGCATGAAGGGCCGGGGAGG + Intergenic
986422870 5:7601686-7601708 AGAAGAATGAAGGGTCTGGAAGG - Intronic
987586770 5:19865624-19865646 ATGAGCATTAAGCACCTGGGTGG - Intronic
988520546 5:31941417-31941439 GGGAGCAATAAAGACCTGGAGGG + Intronic
989400082 5:40999424-40999446 AGGAGCATGAAGGGCTCAGATGG + Intronic
990952779 5:61314212-61314234 ATGAGCAGGAATGACCTGGGTGG - Intergenic
990976504 5:61565832-61565854 AGGAGCATGAAGAGGCTGGTAGG - Intergenic
995063620 5:107837586-107837608 TGGAGCATGCAGGACCGGCATGG - Intergenic
995440131 5:112182121-112182143 AGGAGCATGAAGGAACTTTCCGG + Intronic
997154147 5:131533946-131533968 AGAAGCATGAAGAACAAGGATGG - Intronic
997367766 5:133336756-133336778 GGGAGGATGAAGGACCTGGCTGG - Intronic
997564590 5:134877168-134877190 AGGAGGATGAAGGATTTGGCAGG + Intronic
998069177 5:139183381-139183403 AGGAGCACCATGGACATGGAGGG - Intronic
999287540 5:150403070-150403092 AGGACCAGGAAGGACTAGGAAGG - Intronic
999858031 5:155616554-155616576 AGGAGCATGATGGAACTGGATGG - Intergenic
1004324786 6:14664875-14664897 AGGAGAATGATGGAGCTGGAAGG + Intergenic
1004372764 6:15066794-15066816 AGGAGGAAGAAGGCCTTGGAGGG + Intergenic
1005915079 6:30344692-30344714 AGGATCATGAGGGTGCTGGAGGG - Intronic
1006004279 6:30990033-30990055 AGGAGAATGAAGCATCTGTAAGG + Intergenic
1006059529 6:31410218-31410240 AGGAGCATGAAGGTGGTGGAAGG - Intronic
1006190035 6:32202006-32202028 AGGAGGAGGAAGGACGTAGATGG - Intronic
1006403005 6:33828731-33828753 AGGAGGCTGAAGGACCTGCCTGG - Intergenic
1006675292 6:35758374-35758396 AGAAGCAGGAAGGGCATGGAGGG + Intergenic
1006987293 6:38184428-38184450 TGGAACATGAAGCCCCTGGAGGG + Intronic
1007126932 6:39433290-39433312 GGGAGCAGAAAGGACGTGGAGGG + Intronic
1008892127 6:56507232-56507254 AGGACCAGGTAGGACCTGTAAGG + Intronic
1009774936 6:68194500-68194522 AGGAGCAGCAAGGAGCTGGGAGG + Intergenic
1010426580 6:75734713-75734735 AGGAGCATGAAAGATGGGGATGG + Intergenic
1011504792 6:88029518-88029540 AGGAGCAAGAAGGAGTGGGAGGG + Intergenic
1014663037 6:124197720-124197742 AGGGGCATGAAGGACCTTTCTGG - Intronic
1014895726 6:126897150-126897172 AGGAGCATCAGGGACTTGGAGGG + Intergenic
1015057401 6:128920444-128920466 TGGAGCATGAGGGACCGGCACGG - Intronic
1015226071 6:130858991-130859013 AGGAGCAGGGAGGACCCAGAGGG + Intronic
1017931444 6:158959048-158959070 AGCAGCATGCAGCACCTGCATGG - Intergenic
1019492681 7:1322564-1322586 AGGAGCAGGGGGGAGCTGGAGGG - Intergenic
1019772411 7:2891835-2891857 AGGAGGAAGAAGGTTCTGGAAGG + Intergenic
1019921618 7:4166945-4166967 AGGAGGAGGCAGGACCTGCAGGG - Intronic
1021827653 7:24571663-24571685 GGCAGCAAGAAGGACCTGAAAGG + Intergenic
1022995556 7:35751548-35751570 TGAGGCATGAAGGACCAGGAAGG - Intergenic
1024543299 7:50496842-50496864 AGAAGCTTGAGGGACCTGGGGGG + Intronic
1024775886 7:52784812-52784834 AGGAGCATTAGGGATCTTGAGGG + Intergenic
1026180243 7:68033009-68033031 ATGAGGATGAAGGACCCAGATGG - Intergenic
1027360850 7:77408076-77408098 AGGAGCATGAAGGACTTCTGAGG + Intronic
1028651214 7:93152380-93152402 ATGAGCATGAAGTATCAGGAAGG - Intergenic
1029111226 7:98213921-98213943 ATGAGGATGAAGCACCTGGGCGG - Intergenic
1029572497 7:101379471-101379493 AGAGGCAGGAAGGATCTGGAGGG - Intronic
1029582901 7:101449154-101449176 AGGAGCAGGAAGGACCTCCAAGG + Intronic
1029596238 7:101538891-101538913 AGGGGCGTGAAGGACCTGCTGGG - Intronic
1031877114 7:127154285-127154307 AGTAGCAGGAAGCAGCTGGAGGG - Intronic
1034517769 7:151594067-151594089 TGGAGCAGGAAGAGCCTGGAAGG + Intronic
1034884931 7:154792080-154792102 ATTAGCATGAAGGACATAGAGGG + Intronic
1035287219 7:157814239-157814261 TGGAGCTTTAAGGACCTGGGAGG - Intronic
1035344122 7:158187247-158187269 ACCAGCATGAAGGCCCTGAAAGG + Intronic
1035689178 8:1548688-1548710 AGGAGCATGAAGGGCCTTTCCGG + Exonic
1037709445 8:21343878-21343900 TGGAGCATGAAGCATGTGGAAGG - Intergenic
1037837743 8:22224161-22224183 AGGAGCAGGAAGGGCTGGGAGGG + Intronic
1040103615 8:43526305-43526327 AGGAGGATGGTGGACCTGGAAGG + Intergenic
1041475587 8:58261560-58261582 AGCAGCAAACAGGACCTGGAAGG + Intergenic
1043092697 8:75925185-75925207 AGGAACATGAATGACCTGATGGG + Intergenic
1043354657 8:79398502-79398524 AGGAGCATTGAGGAACTTGAAGG - Intergenic
1044386269 8:91592207-91592229 TGGAGCAGGGAGGAGCTGGAAGG + Intergenic
1044717340 8:95112706-95112728 AGGAGCATGGAGGGACAGGAGGG - Intronic
1045225488 8:100240419-100240441 AGGAGCCTGGAAGACCTGCAGGG + Exonic
1045579351 8:103461871-103461893 AGGAACATGAAGGAGTTGGTGGG - Intergenic
1045835263 8:106513222-106513244 AGGAGCAGGAAAGGCCTGGTAGG - Intronic
1046089719 8:109487249-109487271 AGGAGCATGAAGAAAGTGGATGG - Intronic
1047215089 8:122869618-122869640 AGGAGGCTGCAGGACCTGCATGG - Intronic
1047921453 8:129638886-129638908 TGGAGTATGAACCACCTGGATGG + Intergenic
1047981040 8:130182454-130182476 AGGAGCGTGAAAGAACTGCAAGG + Intronic
1048811516 8:138291005-138291027 AGGAGGCTCAGGGACCTGGAAGG + Intronic
1052738728 9:32372924-32372946 AGGAGCAAAAAGGACGTGGAAGG + Intergenic
1057040301 9:91843119-91843141 AAGAGCATGTTGGAGCTGGAGGG + Intronic
1057113808 9:92501286-92501308 AGGAGCATCAAAGACTAGGAGGG + Intronic
1058561891 9:106239087-106239109 AGAAGCAGGAAGGAAATGGATGG - Intergenic
1058713181 9:107698646-107698668 AGGAGCAGGGAGGATGTGGATGG + Intergenic
1059961137 9:119565505-119565527 AGTGGCATGTAGGACCAGGAGGG - Intergenic
1060558260 9:124521363-124521385 TGGAGCCAGAAGCACCTGGAAGG - Exonic
1061635490 9:131905839-131905861 GGGAGGAAGAAGGAACTGGAAGG - Intronic
1061958288 9:133974969-133974991 AGGGGCATGAATCACGTGGAAGG - Intronic
1062025260 9:134337332-134337354 AGGAGCCTGATGGATGTGGATGG - Intronic
1062149611 9:135010935-135010957 AGGAGCATGGAGGAGGTGGCTGG - Intergenic
1062395107 9:136349659-136349681 AGGAGCAGGAAGTACCAGGAAGG + Exonic
1185913791 X:4011641-4011663 AGGAGCAGGAAGGAGAAGGAAGG - Intergenic
1185928311 X:4171899-4171921 AGGAGTATGAAGGACCCAGCAGG + Intergenic
1186013045 X:5158774-5158796 AGGAGCATGAAGGAATTTGTGGG + Intergenic
1189732300 X:44034014-44034036 TGGAGCAACCAGGACCTGGATGG + Intergenic
1190878219 X:54474690-54474712 AGGAAGATGAATCACCTGGAGGG + Intronic
1193797820 X:85898044-85898066 AAGAGAATGAAAGAGCTGGAAGG + Intronic
1195317726 X:103695101-103695123 AGAGGCAAGAAGGACCAGGAAGG - Intergenic
1195901354 X:109800892-109800914 AGAAGCATGAAGTATCAGGAAGG + Intergenic
1197349831 X:125370099-125370121 ACAAGCATGAAGGCCTTGGAGGG - Intergenic
1197952829 X:131916628-131916650 ATGATCATGAAAGACTTGGAAGG - Intergenic
1198462963 X:136880765-136880787 ACGAGGCTGAAGGACCCGGATGG + Intergenic
1199299690 X:146198433-146198455 AGGAAGATGAAGGACACGGAAGG + Intergenic
1202592220 Y:26497394-26497416 AAGAGCATGAAGGTGGTGGAGGG + Intergenic