ID: 1158512751

View in Genome Browser
Species Human (GRCh38)
Location 18:58106150-58106172
Sequence AGCACGGATGTCCCTACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158512751_1158512755 -8 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT No data
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG No data
1158512751_1158512760 16 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT No data
Right 1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG No data
1158512751_1158512763 21 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT No data
Right 1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG No data
1158512751_1158512754 -9 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT No data
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG No data
1158512751_1158512761 20 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT No data
Right 1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158512751 Original CRISPR AGCACGGATGTCCCTACACA GGG (reversed) Intronic