ID: 1158512751

View in Genome Browser
Species Human (GRCh38)
Location 18:58106150-58106172
Sequence AGCACGGATGTCCCTACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158512751_1158512755 -8 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 173
1158512751_1158512761 20 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 79
1158512751_1158512763 21 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 121
1158512751_1158512754 -9 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1158512751_1158512760 16 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158512751 Original CRISPR AGCACGGATGTCCCTACACA GGG (reversed) Intronic
904203677 1:28838510-28838532 AGCACTGAAGTTCCAACACAGGG + Intronic
904851649 1:33464000-33464022 CTAACGGATGTCCCTTCACATGG + Intergenic
907957523 1:59244358-59244380 ACCAGGGATGTCCATACATAGGG - Intergenic
910472846 1:87573653-87573675 AGGACTGATGTCCTGACACAGGG + Intergenic
912963814 1:114219517-114219539 AGCACGGATGAATCTACAAAGGG - Intergenic
913333139 1:117683808-117683830 GGCAGGGATGTTCCCACACAGGG - Intergenic
920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG + Intronic
1064783447 10:18868012-18868034 AGCACTGAGGTCCCTGCAAATGG - Intergenic
1076019719 10:127062635-127062657 AGAAGGGATTTCACTACACATGG - Intronic
1079910028 11:26298409-26298431 ACAACAGAAGTCCCTACACATGG + Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083925633 11:65804328-65804350 CCCACAGAGGTCCCTACACAAGG - Intergenic
1084403895 11:68960142-68960164 AGCACAGATGGCCCTGGACAGGG - Intergenic
1091249337 11:134129086-134129108 ACCAGGGATGTGCCTGCACAGGG - Intronic
1096880274 12:54662004-54662026 AAAAAGGATTTCCCTACACAGGG - Intergenic
1102831544 12:116006371-116006393 ACCAAGGATGTCACTACACCAGG - Exonic
1103954383 12:124568031-124568053 CGCAGGGAGGGCCCTACACAGGG + Intergenic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1117722208 14:58638569-58638591 AGCACGGCTGTTCCTGCCCAGGG + Intronic
1128662295 15:69510952-69510974 AAGATGGATGTCCCTACTCAAGG - Intergenic
1130039827 15:80397250-80397272 AGCACATATCTCACTACACAAGG - Intronic
1136606433 16:31337385-31337407 ATCACGGAAGGTCCTACACATGG - Intergenic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG + Intronic
1154067155 18:11118157-11118179 GGTACAGATGTCCCTACAAATGG + Intronic
1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG + Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
926424825 2:12731277-12731299 AGCACAGCCCTCCCTACACACGG - Intronic
946994542 2:225376417-225376439 AGCAAGGTTGTCTCTACTCAAGG - Intergenic
948663576 2:239521162-239521184 AGCAGGGATGTCTGTCCACAGGG + Intergenic
1171147975 20:22802474-22802496 TGCAGGGATGTCCGCACACAAGG + Intergenic
1175318168 20:58066543-58066565 AGCACGGAGCTCATTACACATGG + Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1179382241 21:40910594-40910616 ACCACATGTGTCCCTACACACGG - Intergenic
1181027002 22:20132260-20132282 CGCACTGGTGTCCCCACACAAGG - Intronic
1182159723 22:28109384-28109406 AGTAAGTATGTCCATACACACGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184191633 22:42898855-42898877 TGCACGGATGTTTCTGCACAGGG - Intronic
1184300922 22:43560522-43560544 AGCATGGCTGCCCCTACCCAAGG - Intronic
952585564 3:34887945-34887967 AGCACGTATTTCCAAACACAGGG - Intergenic
972213108 4:36862351-36862373 AGCACAGGTGTCCCTATAGATGG - Intergenic
974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG + Intergenic
982156817 4:152531596-152531618 AGCACTACTGTGCCTACACAGGG + Intronic
985107104 4:186510195-186510217 AGCAGGGATGTTCCTTCTCATGG - Intronic
988865780 5:35332881-35332903 AGCTCGGATGTCGCTTCACCAGG + Intergenic
997982216 5:138475428-138475450 AGCCCAGATGTCCCTCCACAGGG - Intergenic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1009713828 6:67361359-67361381 AGCACACATGTACCTAAACATGG + Intergenic
1017402568 6:154081101-154081123 AGCACAGATGTCCAAACAAAAGG + Intronic
1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG + Intronic
1021902524 7:25300764-25300786 AGCACGCTTCTCACTACACATGG - Intergenic
1038992165 8:32879557-32879579 AGCAGAGATGTTCCTACAAAGGG - Intergenic
1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG + Intergenic
1047430210 8:124784693-124784715 TGCATCGATGTCCCTCCACATGG - Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic