ID: 1158512752

View in Genome Browser
Species Human (GRCh38)
Location 18:58106151-58106173
Sequence CAGCACGGATGTCCCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158512752_1158512763 20 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 121
1158512752_1158512754 -10 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1158512752_1158512755 -9 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 173
1158512752_1158512761 19 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 79
1158512752_1158512760 15 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158512752 Original CRISPR CAGCACGGATGTCCCTACAC AGG (reversed) Intronic
900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG + Intronic
903055689 1:20634464-20634486 CAGCAGGGATAACTCTACACAGG - Intronic
904203676 1:28838509-28838531 CAGCACTGAAGTTCCAACACAGG + Intronic
907957524 1:59244359-59244381 CACCAGGGATGTCCATACATAGG - Intergenic
912978540 1:114350807-114350829 CAGCACGGAGATCCCTGCCCAGG - Intergenic
1064274316 10:13892164-13892186 CAGCACGGAGGTCCCCAAGCGGG + Intronic
1075447291 10:122521975-122521997 CAGCACTGATGACCTTTCACAGG - Intergenic
1075959160 10:126552394-126552416 CAGAACAGAAGTCCCCACACTGG + Intronic
1081620853 11:44618534-44618556 CAGCCCGGAAGCCCCTACAGAGG - Intronic
1084403896 11:68960143-68960165 CAGCACAGATGGCCCTGGACAGG - Intergenic
1084512779 11:69616498-69616520 CAGCCCGGAGGCCCCCACACAGG + Intergenic
1090390495 11:126384379-126384401 CAGCCCTGGAGTCCCTACACAGG - Intronic
1096880275 12:54662005-54662027 CAAAAAGGATTTCCCTACACAGG - Intergenic
1098190219 12:67939882-67939904 CAGCAGAAATCTCCCTACACGGG - Intergenic
1101405553 12:104425687-104425709 CAGCACAGAAGTCCCTTCAGAGG + Intergenic
1104081772 12:125435722-125435744 AATCAGGGATTTCCCTACACCGG - Intronic
1112087898 13:96051174-96051196 CTGCATGCATGTCCCTACAAAGG - Intronic
1122533403 14:102445088-102445110 TAGCACAGATGGCCCTAAACAGG + Intronic
1129255388 15:74331275-74331297 CAGCAGGGAAAGCCCTACACGGG + Exonic
1132573001 16:652118-652140 CAGAACGGATGTGCCTCCAACGG + Intronic
1132646689 16:1002490-1002512 CAGCCCCGATGTCCCTCCCCGGG + Intergenic
1132946801 16:2536304-2536326 CAGCACGGTTCTCCCGACCCGGG - Intergenic
1139422933 16:66860096-66860118 CAGCATGAATGTCCAGACACAGG + Intronic
1143112357 17:4559706-4559728 CAGCAGGGCTGCCACTACACGGG + Exonic
1149567615 17:57651220-57651242 CAGCAAGGATGTCCCAGCAACGG - Intronic
1151944082 17:77309928-77309950 CAGCACAGATGTGCCTGCCCGGG - Intronic
1152101582 17:78304768-78304790 CAGCAAGGAGGTCCCCACACTGG - Intergenic
1158370839 18:56801848-56801870 CAACCCAGATGTCCCTAAACAGG - Intronic
1158512752 18:58106151-58106173 CAGCACGGATGTCCCTACACAGG - Intronic
1160717312 19:582214-582236 CAGCACAGATGCCCCTGCTCGGG + Intronic
1160808200 19:1001599-1001621 CAGCAAGGAGGTCCCAACTCCGG + Intronic
930425672 2:51209524-51209546 CAGCACAGATGTTGCTACAGTGG + Intergenic
931424634 2:62159514-62159536 CAGCCCAGATGTCCTTCCACAGG + Intergenic
932400248 2:71475543-71475565 CAGCACGGTTGTCTCTCCTCTGG - Intronic
936151063 2:110022727-110022749 CAGCAGGCATATCCCTACCCTGG - Intergenic
936193614 2:110348642-110348664 CAGCAGGCATATCCCTACCCTGG + Intergenic
943702617 2:191003351-191003373 CAGCAAAGATTTCCCTGCACAGG - Intronic
948663575 2:239521161-239521183 CAGCAGGGATGTCTGTCCACAGG + Intergenic
949032330 2:241802963-241802985 CAGCACGAAGGGCCCTCCACGGG - Intronic
1171380599 20:24731396-24731418 CAGCACGGATGGCCCAAAAGTGG + Intergenic
1173231863 20:41204724-41204746 CAGTACTGATGGCTCTACACTGG - Exonic
1174062211 20:47840715-47840737 CAGCAAGGATGACCCCTCACTGG + Intergenic
1174069282 20:47888516-47888538 CAGCAGGGATGACCCCTCACTGG - Intergenic
1174150651 20:48483923-48483945 CAGCAGGGATGACCCCTCACTGG + Intergenic
1180336527 22:11581367-11581389 CTTCACCGATGTCCCTACAAAGG + Intergenic
1181442540 22:22944193-22944215 CAGCCCAGATGTCCATCCACTGG - Intergenic
952164352 3:30730438-30730460 CTGCACGGAGATCGCTACACAGG + Intronic
955602939 3:60667917-60667939 CAGAACAGATTTCCCCACACTGG + Intronic
961326505 3:126112343-126112365 GAGCACGAATCCCCCTACACAGG - Intronic
966655997 3:182359516-182359538 CAGCACAGATATGCCTACCCAGG - Intergenic
968496811 4:922894-922916 CAGCCCAGATGTCCTTCCACGGG + Intronic
970367698 4:15376884-15376906 CAGCACTGATGTCTGAACACAGG + Intronic
975520162 4:75291959-75291981 CTGCATGCATGTCCCTACAAAGG + Intergenic
982156816 4:152531595-152531617 CAGCACTACTGTGCCTACACAGG + Intronic
985268072 4:188168379-188168401 CAGAACTGATGAGCCTACACGGG + Intergenic
995045586 5:107643124-107643146 TAACACGGATGCCCCTGCACCGG + Intronic
996518972 5:124405236-124405258 CAGCACGGCTGTGCCCACAGAGG - Intergenic
997982217 5:138475429-138475451 CAGCCCAGATGTCCCTCCACAGG - Intergenic
1003883016 6:10495498-10495520 CAGCCCTCATGACCCTACACTGG + Intronic
1010846818 6:80719970-80719992 CAGCACTGGTGTGCCTGCACTGG + Intergenic
1016275386 6:142346028-142346050 CAGTAGGGATTTCCCTTCACAGG - Intronic
1025232228 7:57210449-57210471 CAGCAAGGATGACCCCTCACTGG - Intergenic
1036170985 8:6484614-6484636 CAGCACAGCTGTCCCTCCAGTGG + Intronic
1038992166 8:32879558-32879580 CAGCAGAGATGTTCCTACAAAGG - Intergenic
1050051575 9:1607651-1607673 CAGCTCCGATATCCTTACACTGG + Intergenic
1050400975 9:5254510-5254532 CAGCATCCATGTCCCTACAAAGG + Intergenic
1051675168 9:19551684-19551706 CAGCACCTGTGTCCCTACAGAGG + Intronic
1055266242 9:74498473-74498495 CAGCAGGCATGTCCCTTCGCTGG + Intronic
1193800879 X:85934583-85934605 CTTCACTGATGTCCCTACAAAGG + Intronic
1194937148 X:99964570-99964592 CTGCACCCATGTCCCTACAAAGG - Intergenic