ID: 1158512754

View in Genome Browser
Species Human (GRCh38)
Location 18:58106164-58106186
Sequence ATCCGTGCTGCCCAGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158512744_1158512754 28 Left 1158512744 18:58106113-58106135 CCATCTGGGTAGCAGATGGTCCC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1158512743_1158512754 29 Left 1158512743 18:58106112-58106134 CCCATCTGGGTAGCAGATGGTCC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1158512752_1158512754 -10 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1158512746_1158512754 8 Left 1158512746 18:58106133-58106155 CCCCAGCTAGGCACAAGCCCTGT 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1158512748_1158512754 6 Left 1158512748 18:58106135-58106157 CCAGCTAGGCACAAGCCCTGTGT 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1158512742_1158512754 30 Left 1158512742 18:58106111-58106133 CCCCATCTGGGTAGCAGATGGTC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1158512751_1158512754 -9 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1158512747_1158512754 7 Left 1158512747 18:58106134-58106156 CCCAGCTAGGCACAAGCCCTGTG 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158512754 Original CRISPR ATCCGTGCTGCCCAGGATCC TGG Intronic
900304289 1:1996100-1996122 ATCCCAGCTGCCCAGGAGGCTGG - Intronic
900352263 1:2240827-2240849 ATCCGTGCTGCCCAGTGTGGGGG + Intronic
903042633 1:20542793-20542815 CTCCATGCTGCTCCGGATCCTGG - Intergenic
904467291 1:30715872-30715894 ATCAGTGGTGTCCAGGGTCCAGG + Intronic
907984878 1:59520916-59520938 AACCGTGCTGCGCAGGAGCCAGG + Intronic
911621243 1:100068145-100068167 ATGGGTGCTCCCCAGGATGCTGG - Exonic
916045608 1:160998004-160998026 ATCCCAGCTGCTCAGGAGCCTGG - Exonic
921361601 1:214334981-214335003 CCCTGTGCTGCCCAGGAGCCAGG + Intronic
922493857 1:226040705-226040727 ATCCGTGGTGCAGAGGCTCCTGG - Intergenic
924877600 1:248122374-248122396 ATCTGTAGAGCCCAGGATCCAGG - Intergenic
924879590 1:248145590-248145612 ATCCATAGAGCCCAGGATCCAGG - Exonic
924882742 1:248180428-248180450 ATCTGTAGAGCCCAGGATCCAGG - Exonic
924884847 1:248203510-248203532 ATCCGTAGAGCCCAGGATCCAGG - Exonic
924894728 1:248324104-248324126 ATCTGTAGAGCCCAGGATCCAGG + Exonic
1062949469 10:1487104-1487126 ATCCGGCCTCCCCAGCATCCGGG - Intronic
1063250099 10:4264620-4264642 ATCCTTGTTGCCCTGGCTCCTGG + Intergenic
1074974813 10:118571427-118571449 ATTCCTGCTGCCCAGGACCATGG - Intergenic
1075722001 10:124592852-124592874 ATCCAAGCTGCCCGGGCTCCTGG - Intronic
1076228988 10:128804335-128804357 ATCCTAGCTGCCTGGGATCCAGG + Intergenic
1076427525 10:130378358-130378380 ACCCGTGCTGCACAGCATCTTGG - Intergenic
1076677681 10:132155899-132155921 CTCCGTGCTGCACAGGTCCCCGG - Intronic
1076744095 10:132504137-132504159 AGACGTGCTGCCCAGGACCCTGG + Intergenic
1084050966 11:66599571-66599593 GTCCATGCAGCCCAGGCTCCAGG - Exonic
1084571722 11:69963683-69963705 GTGCGTGCTGCCCAGGCTTCAGG - Intergenic
1089740411 11:120578357-120578379 ATCAGTGCTGCCCAAGAAGCTGG + Intronic
1093063625 12:14633023-14633045 ATGCCTGCTGCCCAGGAACCCGG + Intronic
1098207847 12:68132217-68132239 AGACGTGCTGTCCAGGAACCAGG + Intergenic
1098465667 12:70783733-70783755 ATCCATGGTGCCCAGGCTGCTGG + Intronic
1100701090 12:97149268-97149290 ATCCCAGCTTCCCGGGATCCTGG - Intergenic
1108876242 13:55054299-55054321 ATCCGTGAGGCCAAGAATCCCGG + Intergenic
1112698478 13:101977181-101977203 ATCCCTCATGCCCAGGACCCAGG + Intronic
1114670454 14:24408175-24408197 ATCCGTGGTGACCAGCATGCAGG + Exonic
1117061451 14:51967682-51967704 AGCTGTGCTGCCCTGGGTCCTGG - Exonic
1119405032 14:74393224-74393246 AGCCCTGCTGACCAGGAACCAGG - Intergenic
1121664686 14:95663477-95663499 ATCCGAGCAGCGCAGGATCCAGG + Intergenic
1123476341 15:20594516-20594538 ATCTGTGTTGCTCAGGATCCAGG - Intergenic
1123641670 15:22405848-22405870 ATCTGTGTTGCTCAGGATCCAGG + Intergenic
1130925979 15:88386246-88386268 ATCTGTGCTGCCCACCGTCCTGG + Intergenic
1133293430 16:4737650-4737672 AGCCCTGCTGCTCAGGAGCCTGG - Intronic
1133865590 16:9638937-9638959 ATCCCTGCTGCTCAGGAGGCTGG - Intergenic
1135074140 16:19378978-19379000 AGCCATGTTGCCCAGGATCCTGG - Intergenic
1135494868 16:22942600-22942622 ATCTGTACTGCCAAAGATCCGGG + Intergenic
1137720748 16:50625983-50626005 AGCCATGCTGCCCAGGAGCTTGG + Intronic
1138659617 16:58509499-58509521 ATCTGTGGGGCCCAGCATCCGGG - Intronic
1139429052 16:66901313-66901335 AGCCCTGCTGCCCAGGGCCCAGG - Intergenic
1140047909 16:71454705-71454727 CTCCATGCTGCCCAGGCTGCAGG + Intronic
1140188022 16:72791674-72791696 ACCCCTGCAGCCCAGGACCCTGG - Intronic
1142379556 16:89723599-89723621 ATCCGTGCTGGGCAGGGTCTTGG - Exonic
1142887639 17:2922655-2922677 ATCCCTGCTGCCCCGGGACCTGG + Intronic
1145988724 17:29065277-29065299 CTCTGTGCTGCCCAGGGCCCAGG - Intergenic
1146686630 17:34845578-34845600 ATCAGAGATGCCCAGGTTCCAGG + Intergenic
1151194753 17:72423604-72423626 GTCCATGTTGCCCAGGAGCCTGG + Intergenic
1152322969 17:79618732-79618754 CTCTGTGCTTCCCAAGATCCAGG + Intergenic
1152961248 18:81823-81845 ATCCTTGCTGCACAGGGCCCAGG + Intergenic
1157473652 18:48008216-48008238 GTCGGTGCTTCCCAGAATCCCGG + Intergenic
1158512754 18:58106164-58106186 ATCCGTGCTGCCCAGGATCCTGG + Intronic
1159024023 18:63166388-63166410 ATGCGTGCTGTCCAGGGTCCAGG - Intronic
1160153519 18:76413352-76413374 CTCCCTGCTGCCTAGGAGCCTGG - Intronic
1161109903 19:2463207-2463229 ATCCGGGCTCCCCGAGATCCAGG - Intergenic
1161216888 19:3099122-3099144 CCCCGTGCTGCCCAGGGTCCAGG - Intronic
1161537665 19:4830285-4830307 ACCCATGTTACCCAGGATCCTGG + Intronic
1167346206 19:48947083-48947105 ATCCATGGTGCCCAGGCTGCTGG - Intergenic
1167807707 19:51800004-51800026 ATCGCTGCTCCCCAGGAGCCTGG - Intronic
1168429583 19:56267573-56267595 ATCCGTGCTACCCAGAATGGTGG - Intronic
927193440 2:20532440-20532462 CTCCCAGCTGCCAAGGATCCAGG - Intergenic
927511666 2:23647864-23647886 ATCCTTGCTGCCCCTGACCCCGG - Intronic
932434248 2:71693976-71693998 TTCCCTGCTGTCCAGGATCCGGG + Intergenic
932485286 2:72080902-72080924 ATCCATGGTGCCCAGGCTGCTGG - Intergenic
932563907 2:72893892-72893914 CTCCCTGCAGCCCAGGATTCTGG + Intergenic
935147184 2:100403872-100403894 TCCTGTGCTGCCCAAGATCCAGG + Intronic
936627453 2:114163595-114163617 AACAGAGCTGCCCAGCATCCTGG - Intergenic
938207956 2:129439783-129439805 GTCTGTGCAGCCCAGGAGCCTGG - Intergenic
938295575 2:130176898-130176920 GGCTGTGATGCCCAGGATCCTGG + Intronic
938295577 2:130176909-130176931 ATCAGTGGAGGCCAGGATCCTGG - Intronic
938461046 2:131496915-131496937 ATCAGTGGAGGCCAGGATCCTGG + Intergenic
938461048 2:131496926-131496948 GGCTGTGATGCCCAGGATCCTGG - Intergenic
948822485 2:240557223-240557245 ACCCCTGCTGCCGAGGAGCCGGG - Exonic
948927005 2:241105690-241105712 CTCCGAGCTGCTCAGGTTCCAGG - Intergenic
1169599003 20:7235645-7235667 ATCTGTACTGGCCAGGATCTGGG + Intergenic
1171349335 20:24490802-24490824 CTCTGTGCTGCCCTGGAGCCTGG - Intronic
1173115200 20:40235221-40235243 ATCCAAATTGCCCAGGATCCTGG - Intergenic
1173357684 20:42309413-42309435 ATCAAGGCTGCCCAGGAGCCTGG + Intronic
1174189774 20:48731990-48732012 GTCCCTGCTGCCCAGGCTCTGGG - Intronic
1176232706 20:64040273-64040295 GTCCAGGCTGCCCAGGGTCCTGG + Intronic
1176965743 21:15209720-15209742 ATCCTTGATGCCCAGAAGCCAGG - Intergenic
1177319048 21:19496079-19496101 ATCCATGCTACCCAGCATCTTGG - Intergenic
1179793459 21:43768746-43768768 ACCCGTGCTGCAAAGGAGCCTGG + Intergenic
1180014572 21:45074093-45074115 CGCGGTGCTGCCCAGGCTCCCGG - Intronic
1180155981 21:45977631-45977653 CTCTGTGCTTCCTAGGATCCTGG + Intergenic
1180178975 21:46109537-46109559 ATCCATGGTGCCCAGGCTGCTGG + Intronic
1180600362 22:17011461-17011483 ATCTCTGCTGCACAGGGTCCAGG - Intergenic
1183841748 22:40503624-40503646 ATCAGTGTTTCCCAGGATACTGG + Intronic
954136966 3:48586331-48586353 ATCCGTGAGGCCCAGGCTTCTGG - Exonic
960960868 3:123069197-123069219 ATAAGTGCTCCCCAGGTTCCTGG + Intronic
961098155 3:124175329-124175351 ATGCGCGCTGCCGAGGGTCCAGG + Intronic
961098170 3:124175417-124175439 ATGCGCGCTGCCGAGGGTCCAGG + Intronic
961098221 3:124175681-124175703 ATGTGCGCTGCCCAGGGTCCAGG + Intronic
967049872 3:185772968-185772990 ATCCCTGCTTCCCAAGCTCCAGG + Intronic
967995376 3:195162252-195162274 ATCCTGGCTGCCCAGGAGCCCGG - Intronic
970171492 4:13295363-13295385 ATCCCTGCAGCCCAGACTCCTGG + Intergenic
970852362 4:20616944-20616966 TTCCGTTCTGCCCAGGGGCCTGG - Exonic
976539958 4:86262886-86262908 TTCCATGCTGCCCAGCCTCCTGG - Intronic
978145965 4:105372148-105372170 ATCCTGGCTACCCAGGACCCTGG - Intronic
984785467 4:183563636-183563658 ATCCCTGCTGCTCAGGACCCAGG - Intergenic
984785679 4:183565381-183565403 ATCCTTGCTGCTCAGGACCCAGG - Intergenic
985669819 5:1201521-1201543 CTCCGTTCTGCCCAGGTGCCTGG + Intergenic
987961633 5:24817363-24817385 AACTCAGCTGCCCAGGATCCGGG + Intergenic
988589531 5:32536801-32536823 TTCCCTGCTGCCCCCGATCCGGG + Intronic
989230851 5:39085041-39085063 ATCAGTGGTGGCCAGGATCTTGG + Intergenic
997739265 5:136239409-136239431 ACCCGTTTTTCCCAGGATCCTGG - Intronic
1003437899 6:6111083-6111105 AATAGTGCTGCCCAGGAGCCAGG + Intergenic
1006310880 6:33258424-33258446 TTCTGTGTTGCCCAGGCTCCTGG - Intronic
1007499042 6:42281268-42281290 CTCCCTGCAGCCCAGGCTCCGGG - Intronic
1012948788 6:105495708-105495730 ATCCCTCCTGCCCCAGATCCGGG - Intergenic
1013524600 6:110962718-110962740 ATCCCTGTTGCTCAGGAGCCTGG - Intronic
1019333895 7:473630-473652 CTCCCTGCAGCCAAGGATCCTGG + Intergenic
1021852518 7:24822370-24822392 ATCCCTTGAGCCCAGGATCCAGG + Intronic
1029495908 7:100895463-100895485 ACCCGAGCTGCGCAGGTTCCCGG - Intronic
1031265279 7:119572813-119572835 AACCCTCCTGCCCAGGAGCCTGG - Intergenic
1032431007 7:131861575-131861597 ATACCTGCTCCCCAGGATTCAGG + Intergenic
1033251380 7:139763198-139763220 ATCCATGCTGTTCAGGATTCAGG + Intronic
1034967736 7:155401816-155401838 ATCAGTGCTCCCCAGGCTGCTGG - Intergenic
1035465174 7:159070257-159070279 CTCCGTGCAGCCCTGGATGCAGG - Intronic
1038050805 8:23808982-23809004 ATCAGTGTTGGCCAGGATTCTGG - Intergenic
1042642712 8:70953767-70953789 ATCAGTGGGGACCAGGATCCAGG - Intergenic
1049251023 8:141588998-141589020 AGCCCGGCTGCCCAGGACCCTGG - Intergenic
1049638474 8:143702483-143702505 AGCCATGCTGCCCAGGAAACGGG - Intronic
1049683854 8:143931470-143931492 ACCCGTGCAGCCCAGACTCCAGG + Intronic
1053434222 9:38064922-38064944 CTCTGTGTTGCCCAGGCTCCTGG - Intronic
1053586514 9:39464375-39464397 CTCCGCGCGGCCCAGGAACCTGG - Intergenic
1054579792 9:66900858-66900880 CTCCGCGCGGCCCAGGAACCTGG + Intronic
1055085179 9:72306423-72306445 ATCCCTTGAGCCCAGGATCCTGG + Intergenic
1057231390 9:93323725-93323747 ACCCCTGCAGCCCAGGACCCTGG - Intronic
1057444902 9:95106945-95106967 ATCTGTGCTGGGCAGCATCCTGG + Intronic
1060938403 9:127528989-127529011 ATTCGAGCTCCCCAGGATCTGGG - Intronic
1060940307 9:127539656-127539678 ATCAGTGCTGCCCTGGCCCCAGG + Intronic
1062502667 9:136858051-136858073 GTCCATGCTGCCCAGGCGCCAGG - Exonic
1062736910 9:138142313-138142335 ATCCTTGCTGCACAGGGCCCAGG - Intergenic
1190656841 X:52620120-52620142 ATCCCAGCTACCCAGGAGCCTGG + Intergenic
1196320501 X:114334666-114334688 ATAGGTGCTGCCCTGGACCCTGG + Intergenic
1200231112 X:154444371-154444393 ATGCGCGCTGCCCAGGTCCCCGG + Intronic