ID: 1158512755

View in Genome Browser
Species Human (GRCh38)
Location 18:58106165-58106187
Sequence TCCGTGCTGCCCAGGATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158512747_1158512755 8 Left 1158512747 18:58106134-58106156 CCCAGCTAGGCACAAGCCCTGTG 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 173
1158512752_1158512755 -9 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 173
1158512743_1158512755 30 Left 1158512743 18:58106112-58106134 CCCATCTGGGTAGCAGATGGTCC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 173
1158512748_1158512755 7 Left 1158512748 18:58106135-58106157 CCAGCTAGGCACAAGCCCTGTGT 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 173
1158512744_1158512755 29 Left 1158512744 18:58106113-58106135 CCATCTGGGTAGCAGATGGTCCC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 173
1158512746_1158512755 9 Left 1158512746 18:58106133-58106155 CCCCAGCTAGGCACAAGCCCTGT 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 173
1158512751_1158512755 -8 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158512755 Original CRISPR TCCGTGCTGCCCAGGATCCT GGG Intronic
900304288 1:1996099-1996121 TCCCAGCTGCCCAGGAGGCTGGG - Intronic
900594176 1:3472887-3472909 TCCCTGCTGTCCAGCATCCCAGG + Intronic
902514648 1:16983637-16983659 TCAGCCCTGCCCAGGAGCCTAGG + Intergenic
902639715 1:17759278-17759300 TCCCTGCTGCAGAGGCTCCTCGG - Intronic
903131875 1:21284800-21284822 TTCGTGCAGCCCAGGTTGCTGGG - Intronic
903841526 1:26245135-26245157 TCCCTGCTACTCAGGAGCCTAGG - Intronic
903956918 1:27032035-27032057 TCCGTCCTCCCCAGGAACCACGG - Intergenic
905402804 1:37715798-37715820 ACCGTCCTGCCATGGATCCTGGG + Intronic
907408062 1:54265843-54265865 CCAGTGCTGCCCTGGCTCCTTGG - Intronic
910758185 1:90712499-90712521 TCCATGCTGCCCAGCAGGCTTGG + Exonic
915560125 1:156682263-156682285 TCCCTGCTTCCCAGGTGCCTTGG - Intergenic
919753358 1:201052077-201052099 GGCCTGCAGCCCAGGATCCTCGG + Intronic
922638425 1:227201219-227201241 TCACTGCAGCCCAGGCTCCTGGG + Intronic
924444618 1:244117607-244117629 TCAGAGCTACCCAGGATGCTGGG - Intergenic
924739901 1:246789008-246789030 TCCGGCCTGGCCAGGATTCTGGG + Intergenic
1063250100 10:4264621-4264643 TCCTTGTTGCCCTGGCTCCTGGG + Intergenic
1063662960 10:8046436-8046458 TCCATGCTCACCAGGATGCTGGG + Intergenic
1065435636 10:25701761-25701783 TCCCTGCTGCCCTGTATGCTTGG + Intergenic
1070362188 10:75701346-75701368 TCCCTGTTCCCCAGGATCATAGG - Intronic
1070736362 10:78866281-78866303 TCCGTGCCACCCAGCATCTTAGG + Intergenic
1074855510 10:117470274-117470296 TCCCTGCTGTCCAGGTCCCTGGG + Intergenic
1075098577 10:119489986-119490008 CCCGGGCTCCCCAGGCTCCTTGG - Intergenic
1076744096 10:132504138-132504160 GACGTGCTGCCCAGGACCCTGGG + Intergenic
1077377197 11:2210640-2210662 GCCGGGCTGCCCAGGGACCTCGG - Intergenic
1077600141 11:3568956-3568978 ACAGTGCTGCCCAGGCCCCTCGG + Intergenic
1079288214 11:19159899-19159921 TCAGGGCTTCCCAGGGTCCTTGG - Intronic
1081933730 11:46890206-46890228 TCCCTGCCCCCCAGGAGCCTTGG - Intronic
1083225381 11:61281418-61281440 TCCCTGTAGCCCAGGATACTCGG + Intronic
1083596339 11:63919665-63919687 GCCGCGCTGCCCAGCTTCCTTGG - Intergenic
1083855384 11:65390623-65390645 TTCCTGCTGCCCCGGCTCCTCGG + Intronic
1085426371 11:76408468-76408490 TCCCTGAAGCCCAGGATCCCTGG + Intronic
1085637915 11:78172356-78172378 TCCTTGCTGCACAGCACCCTTGG + Exonic
1089667454 11:120029490-120029512 CCCATGCTGCCCAGGAGCCCTGG - Intergenic
1089692794 11:120197354-120197376 CCCTTTCTGCCCAGGCTCCTCGG - Intergenic
1091837750 12:3597655-3597677 GCCCTGCAGCCCAGGAGCCTGGG - Intergenic
1093063626 12:14633024-14633046 TGCCTGCTGCCCAGGAACCCGGG + Intronic
1101736631 12:107468157-107468179 TCCCTGCTGCCCAGCCTTCTGGG - Intronic
1102349051 12:112178899-112178921 GCTGGGCTGCCCAGGCTCCTTGG + Intronic
1102803969 12:115763084-115763106 TCCTTAGTGCCCAGGGTCCTTGG + Intergenic
1105855277 13:24366308-24366330 GCCCTGCTGCCCTGGGTCCTGGG + Intergenic
1106286824 13:28325199-28325221 TCCATCCTGCCCAGGTCCCTAGG + Intronic
1106384272 13:29268753-29268775 TCTGTGTTGTCCAGGATCCCAGG + Intronic
1111971565 13:94922519-94922541 TCCAAGATGCCCAGGAACCTGGG - Intergenic
1113612972 13:111661184-111661206 TCAGGGCTGCCCAGGAGTCTGGG - Intronic
1113890313 13:113731982-113732004 CCTGGGCTGCCCCGGATCCTAGG + Intronic
1114355777 14:21906538-21906560 TCCCAGCTGCTCAGGGTCCTTGG - Intergenic
1116073181 14:40074652-40074674 TCCTTGCTGCCAATGCTCCTGGG + Intergenic
1120265618 14:82246819-82246841 GCTGTGGTGCCCAGGATCCCAGG + Intergenic
1122844149 14:104481578-104481600 CCCCTGCTGCCCCGGGTCCTGGG + Intronic
1123032649 14:105459074-105459096 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032691 14:105459192-105459214 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032711 14:105459251-105459273 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032755 14:105459369-105459391 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032776 14:105459428-105459450 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032818 14:105459546-105459568 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032861 14:105459664-105459686 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032881 14:105459723-105459745 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032925 14:105459841-105459863 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032966 14:105459959-105459981 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123032986 14:105460018-105460040 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123033006 14:105460077-105460099 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123033026 14:105460136-105460158 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123033047 14:105460195-105460217 TCCGTGCTGCCCATGGCCCCTGG + Intronic
1123476340 15:20594515-20594537 TCTGTGTTGCTCAGGATCCAGGG - Intergenic
1123641671 15:22405849-22405871 TCTGTGTTGCTCAGGATCCAGGG + Intergenic
1125599734 15:40908761-40908783 TCCTTGCTACTCAGGAGCCTGGG - Intergenic
1129236062 15:74224355-74224377 TCCATGCTGCCCAGGACCTCTGG - Intergenic
1133293429 16:4737649-4737671 GCCCTGCTGCTCAGGAGCCTGGG - Intronic
1133372040 16:5252600-5252622 ACAGTGCTGCCCAGGCCCCTGGG - Intergenic
1135074139 16:19378977-19378999 GCCATGTTGCCCAGGATCCTGGG - Intergenic
1136519507 16:30786841-30786863 CCCGCGCTTCCCAGAATCCTCGG + Intronic
1137720749 16:50625984-50626006 GCCATGCTGCCCAGGAGCTTGGG + Intronic
1137974575 16:53020496-53020518 TCAGTCCTGCCCAGGGTCATTGG + Intergenic
1138647214 16:58434288-58434310 ACTGTGCTGCCCAGAAGCCTGGG + Intergenic
1140047910 16:71454706-71454728 TCCATGCTGCCCAGGCTGCAGGG + Intronic
1141730922 16:85822337-85822359 TCTGGGCTGCCCCGCATCCTGGG + Intergenic
1142185043 16:88690872-88690894 TGCGGGCAGCCCAGGCTCCTGGG + Intergenic
1146264070 17:31439446-31439468 TCTGTGCTGCCCAGCTTCCTAGG + Intronic
1148045490 17:44741421-44741443 TGCATGCTGCCCAGGGTCGTCGG - Exonic
1148798787 17:50210454-50210476 TCCCTGCCCCCCAGGGTCCTGGG + Intergenic
1148881254 17:50729504-50729526 TCCCGGCTGCCCAGGATGCAAGG + Intronic
1151782818 17:76258592-76258614 TCCCAGCTGCCCAGGAAGCTAGG + Intergenic
1153063225 18:1015345-1015367 TCAGGGCTGCCAAGAATCCTAGG + Intergenic
1153766191 18:8376993-8377015 TCTGTTCTTCCCAGGACCCTGGG - Intronic
1155550884 18:26963524-26963546 TCTGCGCTGCCCAGCACCCTAGG - Intronic
1157971584 18:52275785-52275807 TCCATGCACCCCAGGATCCAAGG - Intergenic
1158512755 18:58106165-58106187 TCCGTGCTGCCCAGGATCCTGGG + Intronic
1159024022 18:63166387-63166409 TGCGTGCTGTCCAGGGTCCAGGG - Intronic
1161042563 19:2117746-2117768 TCGGGGCTGGCCATGATCCTTGG - Intronic
1161537667 19:4830286-4830308 CCCATGTTACCCAGGATCCTGGG + Intronic
1161854198 19:6754233-6754255 TCCCTGCTCCCCACGAACCTGGG + Exonic
1163417579 19:17195755-17195777 TCCCTGCTGCCCAGAAATCTTGG + Intronic
1164607435 19:29610347-29610369 TCTGGGCAGCCCAGGATCCCAGG - Intronic
1165824401 19:38697674-38697696 TCCCTGCAGCCCAGGTGCCTAGG + Intronic
1166910080 19:46148276-46148298 TCCATGGTGCCCAGAATCTTCGG + Intronic
1167260009 19:48452963-48452985 GCCGTGCTGACCAGGAGCCCTGG - Exonic
1167627292 19:50600480-50600502 TGCGTGCTGCTCACGTTCCTTGG + Intergenic
927193439 2:20532439-20532461 TCCCAGCTGCCAAGGATCCAGGG - Intergenic
928012991 2:27628562-27628584 TCGGTGCTGCCCAGCAACCCTGG + Exonic
929701926 2:44169410-44169432 TCCCTGCTGCCGCGGAGCCTAGG + Intronic
932079877 2:68704237-68704259 ACCATGTTGCCCAGGCTCCTGGG - Intronic
933844615 2:86315214-86315236 ACTGTGCTTCCCAGGGTCCTTGG - Intronic
933886340 2:86721263-86721285 TCTGTGCCGCCCCGAATCCTTGG + Intronic
937023590 2:118679840-118679862 TCCCTGATGCCCAGTCTCCTTGG - Intergenic
938295576 2:130176908-130176930 TCAGTGGAGGCCAGGATCCTGGG - Intronic
938461047 2:131496916-131496938 TCAGTGGAGGCCAGGATCCTGGG + Intergenic
939843302 2:147214547-147214569 TCCCTGCTTCCTGGGATCCTGGG - Intergenic
947445701 2:230161077-230161099 TCAGTGCATCCTAGGATCCTGGG - Intergenic
948927004 2:241105689-241105711 TCCGAGCTGCTCAGGTTCCAGGG - Intergenic
1170554779 20:17506134-17506156 TCAGGGCTGCCCAGGCTCCTTGG - Intronic
1172087695 20:32400586-32400608 TCCTTGCTGCCCATGGTCTTGGG + Intronic
1172332027 20:34081907-34081929 TCCCTGCTGCCCAGGGTCCATGG - Intronic
1172518606 20:35553205-35553227 GCCATGTTGCCCAGGCTCCTGGG + Intronic
1173183174 20:40819935-40819957 TCTGTGCTGAAAAGGATCCTAGG + Intergenic
1174011469 20:47453221-47453243 TCCCAGCTGCCCAGGAAACTGGG + Intergenic
1175483186 20:59326296-59326318 CCTGTGCAGCCCAGGATTCTAGG + Intergenic
1178040524 21:28635824-28635846 TCTGTGCTGCCCAGTATGCTAGG + Intergenic
1179793461 21:43768747-43768769 CCCGTGCTGCAAAGGAGCCTGGG + Intergenic
1180014571 21:45074092-45074114 GCGGTGCTGCCCAGGCTCCCGGG - Intronic
1181518467 22:23431917-23431939 TCCGTGCTGCCTATAATTCTGGG - Intergenic
1182023253 22:27098553-27098575 ACCATGCTGCCCAGGGTCCTTGG - Intergenic
1183678308 22:39312144-39312166 TCCCTGGAGCCCAGGATGCTGGG - Intergenic
1184716096 22:46282601-46282623 GCCTTGCTGCGGAGGATCCTCGG + Intronic
951567905 3:24030192-24030214 TCAGTGCTGCCCAGGATTCCTGG - Intergenic
953216549 3:40923946-40923968 TCTGTGCTGCCCATGGTTCTTGG + Intergenic
962256302 3:133872365-133872387 TCCCTGCTGCACAGGGCCCTTGG + Intronic
962259621 3:133894690-133894712 TCCTTGCTGCCCAGGGATCTGGG - Intronic
962818213 3:139021040-139021062 TCCGTGCTGTCCAGTATCCGTGG + Intronic
968118614 3:196108666-196108688 TCTGGGCTGTCCAGGATCTTGGG - Intergenic
969739376 4:9013142-9013164 ACAGTGCTGCCCAGGCCCCTGGG - Intergenic
969798558 4:9544657-9544679 ACAGTGCTGCCCAGGCCCCTGGG - Intergenic
971028632 4:22612453-22612475 TCTGCGCTGCCCAGCACCCTAGG - Intergenic
972682596 4:41321143-41321165 TCCGAGCTGCCCAGGAGATTGGG + Intergenic
980788522 4:137587233-137587255 TCTGTGCTTCCCAGGAAGCTCGG + Intergenic
985669820 5:1201522-1201544 TCCGTTCTGCCCAGGTGCCTGGG + Intergenic
986814213 5:11390681-11390703 GCCCGGCTGCCCAGCATCCTGGG - Intronic
989230852 5:39085042-39085064 TCAGTGGTGGCCAGGATCTTGGG + Intergenic
989478750 5:41904154-41904176 TCCTTGCTGCTCAGGATTATGGG + Intergenic
991023900 5:62009060-62009082 ACCATGCTGCCCAGTGTCCTAGG + Intergenic
992286495 5:75240998-75241020 TCTATGTTGCCCAGGCTCCTCGG - Intergenic
997707069 5:135965752-135965774 TCTGTGCTGAGCAAGATCCTAGG - Intergenic
997739263 5:136239408-136239430 CCCGTTTTTCCCAGGATCCTGGG - Intronic
998135211 5:139670980-139671002 TCCCAGGTGCCCAGCATCCTTGG + Intronic
1000397489 5:160791016-160791038 TAGATGCTGCCCAGGTTCCTTGG - Intronic
1001705972 5:173741509-173741531 TCCATGCTGCCCTGGGCCCTGGG - Intergenic
1002107450 5:176887198-176887220 TACCTGCTGCCCAGAACCCTGGG + Exonic
1002948521 6:1785681-1785703 ACCATCCTGCCCAGCATCCTCGG + Intronic
1004468788 6:15909702-15909724 TGCCTGCTGCCCACGACCCTTGG - Intergenic
1005092844 6:22076934-22076956 GCCATGTTGCCCAGGCTCCTGGG + Intergenic
1006310879 6:33258423-33258445 TCTGTGTTGCCCAGGCTCCTGGG - Intronic
1007499041 6:42281267-42281289 TCCCTGCAGCCCAGGCTCCGGGG - Intronic
1013524599 6:110962717-110962739 TCCCTGTTGCTCAGGAGCCTGGG - Intronic
1016307970 6:142703186-142703208 TTCATGCTCTCCAGGATCCTTGG + Intergenic
1020029062 7:4920297-4920319 TTGGAGCTGCCCAGGATGCTGGG + Exonic
1022010252 7:26302552-26302574 TACGTATTGCCCAGGACCCTCGG + Intronic
1023728905 7:43171466-43171488 TGCGTGCTGGCCAGGCTCCAAGG + Intronic
1023865242 7:44235279-44235301 TCCGAGCTGCCCAGCAGCCCTGG + Intronic
1025107665 7:56185708-56185730 TCCTTGCTACCCAGGAACCCAGG + Intergenic
1025234194 7:57222888-57222910 TCCTTGCTGCAAAGGATGCTGGG + Intergenic
1034047070 7:147940731-147940753 TCCCTGTTGCCCAGGATGGTTGG + Intronic
1035279987 7:157772486-157772508 TCAGTGCTGCCCAGAGACCTGGG + Intronic
1035465173 7:159070256-159070278 TCCGTGCAGCCCTGGATGCAGGG - Intronic
1036256299 8:7209374-7209396 ACAGTGCTGCCCAGGCCCCTGGG + Intergenic
1036308350 8:7667958-7667980 ACAGTGCTGCCCAGGCCCCTGGG + Intergenic
1036361185 8:8078120-8078142 ACAGTGCTGCCCAGGCCCCTGGG - Intergenic
1036889789 8:12588881-12588903 ACAGTGCTGCCCAGGTCCCTGGG + Intergenic
1038050804 8:23808981-23809003 TCAGTGTTGGCCAGGATTCTGGG - Intergenic
1044206173 8:89494140-89494162 TCTGTGCTGGCTAGGTTCCTGGG - Intergenic
1048142368 8:131806902-131806924 AACTTGCTGCCCAGGCTCCTAGG - Intergenic
1049485607 8:142858361-142858383 CCGTTGCTGCCCAGGGTCCTGGG - Intronic
1052952747 9:34226590-34226612 TCCTAGCTGCTCAGGAGCCTGGG + Intronic
1053203606 9:36168853-36168875 TCTCTGATGCCCAGGAGCCTTGG + Intergenic
1053333695 9:37242432-37242454 TCCTTGCTTCCCATGATACTTGG + Intronic
1053434221 9:38064921-38064943 TCTGTGTTGCCCAGGCTCCTGGG - Intronic
1053586513 9:39464374-39464396 TCCGCGCGGCCCAGGAACCTGGG - Intergenic
1054579793 9:66900859-66900881 TCCGCGCGGCCCAGGAACCTGGG + Intronic
1055085180 9:72306424-72306446 TCCCTTGAGCCCAGGATCCTGGG + Intergenic
1061245908 9:129401267-129401289 TCCGGTCTGCCTTGGATCCTGGG - Intergenic
1062473733 9:136717750-136717772 CCCCTGCTGCCCAAGATGCTGGG + Intronic
1062504811 9:136867680-136867702 TCCGTGCCGCCCTGGCTCGTCGG + Intronic
1186028129 X:5336643-5336665 GCCATGTTTCCCAGGATCCTTGG - Intergenic
1187679696 X:21754824-21754846 TCTGTTCTGCCCAGCAACCTGGG + Intronic
1190656842 X:52620121-52620143 TCCCAGCTACCCAGGAGCCTGGG + Intergenic
1190998802 X:55637589-55637611 TCCATGGTGCCCAGGCTGCTCGG - Intergenic
1195004869 X:100676075-100676097 TCCCTTCTGCCCAAGACCCTGGG + Exonic
1196151660 X:112381075-112381097 TCGGTGCTGCCCAGCAACCCTGG - Intergenic
1199693790 X:150329096-150329118 TCTGTGCTGCTCAGGGGCCTAGG - Intergenic
1201984697 Y:19953157-19953179 TCCCTGTTGACCTGGATCCTTGG + Intergenic