ID: 1158512758

View in Genome Browser
Species Human (GRCh38)
Location 18:58106175-58106197
Sequence TGGGCAGTGTCCCAGGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158512758_1158512760 -9 Left 1158512758 18:58106175-58106197 CCAGGATCCTGGGACACTGCCCA 0: 1
1: 0
2: 6
3: 28
4: 321
Right 1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 92
1158512758_1158512763 -4 Left 1158512758 18:58106175-58106197 CCAGGATCCTGGGACACTGCCCA 0: 1
1: 0
2: 6
3: 28
4: 321
Right 1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 121
1158512758_1158512765 17 Left 1158512758 18:58106175-58106197 CCAGGATCCTGGGACACTGCCCA 0: 1
1: 0
2: 6
3: 28
4: 321
Right 1158512765 18:58106215-58106237 GGAGCCTGTGTCCAGAACTGTGG 0: 1
1: 0
2: 1
3: 22
4: 232
1158512758_1158512767 21 Left 1158512758 18:58106175-58106197 CCAGGATCCTGGGACACTGCCCA 0: 1
1: 0
2: 6
3: 28
4: 321
Right 1158512767 18:58106219-58106241 CCTGTGTCCAGAACTGTGGATGG 0: 1
1: 0
2: 4
3: 35
4: 297
1158512758_1158512761 -5 Left 1158512758 18:58106175-58106197 CCAGGATCCTGGGACACTGCCCA 0: 1
1: 0
2: 6
3: 28
4: 321
Right 1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158512758 Original CRISPR TGGGCAGTGTCCCAGGATCC TGG (reversed) Intronic
900368886 1:2322786-2322808 TGGGCAGTGGCTGAGGAGCCCGG + Intronic
901404789 1:9038797-9038819 AGGCCAGGGTCCCAGGAGCCCGG - Intronic
902711990 1:18246767-18246789 TTGGGAGCCTCCCAGGATCCCGG + Intronic
903970601 1:27116422-27116444 TTGGCACTGTGCCAGGATTCTGG - Intronic
904186997 1:28713209-28713231 GGAGCTGTGTGCCAGGATCCAGG + Intronic
904576382 1:31507664-31507686 TGGGCTCTGTCCCAGGAGCTGGG + Intergenic
904663926 1:32105576-32105598 TGGGGAGTGTCCCAAGAAGCAGG + Intergenic
904775358 1:32902675-32902697 TGGGCAGTGTCCCAGAGGTCAGG + Intergenic
904819149 1:33229279-33229301 TAGGCACTGTTCCAGGAGCCAGG - Intergenic
905293657 1:36940624-36940646 TGGGCAGTGCCCCGGGAGGCAGG - Intronic
905579994 1:39076968-39076990 TGGGCAGGGTCTCAGCAGCCAGG - Intergenic
905844663 1:41218848-41218870 TGGTCTTTGTCCCAGGTTCCTGG + Intronic
905869997 1:41397906-41397928 TGGGCACTGAGCCAGGATTCAGG + Intergenic
905922756 1:41730253-41730275 GGGGCAGAGGCCCAGGTTCCTGG - Intronic
907312116 1:53544667-53544689 TGGTCAGTGTAACAGGAACCTGG - Intronic
909701259 1:78525851-78525873 TGGTCATTGTCCCTGGTTCCTGG - Intronic
910340270 1:86179261-86179283 TGAGCGGTTTCCCAGGATTCAGG - Intergenic
912856366 1:113171690-113171712 TGGGCAGCTTCTCAGGAACCTGG - Intergenic
913199187 1:116482433-116482455 TGGGGAAAGTCCCAGGATCTGGG - Intergenic
913963001 1:143353842-143353864 TGGCCAGTGTCCCAGGGATCAGG + Intergenic
913965885 1:143377272-143377294 TGGGCACTGCCTCAGGCTCCTGG + Intergenic
914057356 1:144179427-144179449 TGGCCAGTGTCCCAGGGATCAGG + Intergenic
914060259 1:144202880-144202902 TGGGCACTGCCTCAGGCTCCTGG + Intergenic
914118891 1:144763489-144763511 TGGGCACTGCCTCAGGCTCCTGG - Intergenic
914121790 1:144786939-144786961 TGGCCAGTGTCCCAGGGATCAGG - Intergenic
914349956 1:146832191-146832213 TGGGCTGTGGCACAGGACCCAGG + Intergenic
916180134 1:162076237-162076259 TGGGCATGGTCCCAGGCTGCTGG - Intronic
916218752 1:162422003-162422025 GGGGCAGAGTCCCAGAAGCCAGG + Intergenic
917811812 1:178666091-178666113 TGAGTAGTTTCCCAGGATGCAGG - Intergenic
919825274 1:201499065-201499087 TGGGGACTGTCCCTGGATCTGGG - Intronic
920328998 1:205191342-205191364 TGAGCAGTGTGCAAGAATCCAGG - Intronic
922900477 1:229132774-229132796 TGGCCTTTGTCCCAGGCTCCTGG + Intergenic
1066037485 10:31508318-31508340 TGGGCAGGTTCTCAGGCTCCTGG + Intronic
1067456521 10:46423133-46423155 TGGGCTTTGTCCCAGGTTCCTGG - Intergenic
1067630679 10:47961506-47961528 TGGGCTTTGTCCCAGGTTCCTGG + Intergenic
1067741070 10:48896566-48896588 TGGGCAGCCTCTCAGGATGCAGG + Intronic
1069996002 10:72342522-72342544 TGTGCAGTGTCCCGGGGCCCTGG - Intronic
1070161030 10:73866859-73866881 TGGTCAGTGTCCCAGGCCCAGGG - Intronic
1070785567 10:79160337-79160359 TGGGCCTGGTCCCAGGATCTTGG + Intronic
1071478178 10:86042464-86042486 TGAGCAGAGTCCCAGGACCAAGG + Intronic
1075488940 10:122849736-122849758 TTGGCTGTGTCCCAGGCTCCGGG + Intronic
1075784499 10:125039797-125039819 AGGGCAGGGTCCCAGGCTGCTGG + Intronic
1076512496 10:131022583-131022605 TGGTCATTGTCCCAGGACACAGG + Intergenic
1076731554 10:132441465-132441487 GGTGCAGTGGCCCAGGGTCCTGG + Intergenic
1076739525 10:132476463-132476485 TGGGCTGTGTCCTGGGAACCAGG + Intergenic
1076739540 10:132476523-132476545 TGGGCTGTGTCCTGGGAACCAGG + Intergenic
1076807929 10:132868376-132868398 GGAGCAGTGTCCCAGGAACCTGG - Intronic
1077475992 11:2790742-2790764 TGGGCAGTGTCACAAGCTCCTGG + Intronic
1077582071 11:3423099-3423121 TGGGGAGGGGCCCAGGGTCCGGG + Intergenic
1080197481 11:29629442-29629464 GCGGCAGTGACTCAGGATCCAGG + Intergenic
1080606465 11:33869084-33869106 TGGGGAGCGTCCCAGTAGCCTGG + Intronic
1080625779 11:34029402-34029424 AGGGCGGTGTCCCAGTATACAGG + Intergenic
1080948239 11:36998895-36998917 TGGGGAGTTTCCCAGGATCCAGG + Intergenic
1081704937 11:45177165-45177187 TTGGCAGGGTGCCAGGATCCTGG - Intronic
1082003779 11:47408753-47408775 TGGGCCGGCTCCCAGGACCCGGG + Intronic
1082162491 11:48900564-48900586 TCGGCAGAGCCCCAGGACCCTGG + Intergenic
1082174891 11:49048557-49048579 TCGGCAGAGCCCCAGGACCCCGG + Intergenic
1082238932 11:49852172-49852194 TCGGCAGAGCCCCAGGACCCCGG - Intergenic
1082243210 11:49892158-49892180 TCGGCAGAGCCCCAGGACCCTGG + Intergenic
1082281807 11:50278715-50278737 TGGGCAGCGACCCACGCTCCTGG - Intergenic
1082807895 11:57461661-57461683 TGGACAGGGACCCAGAATCCTGG + Intronic
1083215364 11:61215417-61215439 TAGGCAGTGTGCTAGGCTCCGGG + Intergenic
1083218248 11:61234246-61234268 TAGGCAGTGTGCTAGGCTCCGGG + Intergenic
1083888891 11:65585942-65585964 TGGGCAGAGTGCCAGGAACGTGG - Intronic
1084238989 11:67805916-67805938 TGGGGAGGGGCCCAGGGTCCGGG + Intergenic
1084376642 11:68782675-68782697 TGGGCAGTGGCAGAGGGTCCTGG - Intronic
1084495858 11:69502670-69502692 TGGGCAGGGTGCCAGGAAGCAGG - Intergenic
1084629627 11:70339182-70339204 TGGGCAGTGTCCCAGATTTCAGG + Exonic
1084686772 11:70700743-70700765 AGGGCAGGGCCTCAGGATCCCGG + Intronic
1084718534 11:70889450-70889472 TGGGCTGTGTACCCGGTTCCCGG - Intronic
1084833444 11:71786924-71786946 TGGGGAGGGGCCCAGGGTCCGGG - Intergenic
1085026271 11:73238377-73238399 TGGCAGGTGTCCCAGGGTCCAGG + Intergenic
1085246826 11:75108660-75108682 TAGGCAGGTGCCCAGGATCCAGG - Intronic
1086501089 11:87454499-87454521 TGGGCAGTGTGCCAAGACCACGG + Intergenic
1086690883 11:89787529-89787551 TCGGCAGAGCCCCAGGACCCCGG - Intergenic
1086714917 11:90052126-90052148 TCGGCAGAGCCCCAGGACCCCGG + Intergenic
1086983331 11:93222387-93222409 AGGGGAGTGTCCCAGGATGAAGG - Intergenic
1089437078 11:118478097-118478119 TGGGCAGTGTCCCGGCTGCCAGG + Exonic
1090366557 11:126211585-126211607 TTGGCCGTTTCCCCGGATCCAGG + Exonic
1090395341 11:126414854-126414876 TGGGCAGTAACCCAGGGTGCCGG - Intronic
1090419730 11:126566228-126566250 AGGGCACTGTCCCAGGAACAAGG + Intronic
1090536822 11:127651750-127651772 TGGGCAGTGTACCAGGATACTGG + Intergenic
1091800737 12:3323152-3323174 TGGCCTGTGTCCTAAGATCCTGG + Intergenic
1092409678 12:8243547-8243569 TGGGGAGGGGCCCAGGGTCCGGG + Intergenic
1097947523 12:65388408-65388430 TGGGCAGTGCACAAGGAACCTGG - Intronic
1098403146 12:70095118-70095140 TGTGCAGTTGCCCAGGGTCCTGG - Intergenic
1099674822 12:85745305-85745327 TGGGATCTGTCCCTGGATCCTGG + Intergenic
1100745674 12:97643059-97643081 TGGGCAATGGCCCAGAATGCTGG - Intergenic
1101423468 12:104568138-104568160 TGGGCTGGGTCCCATGATCAGGG + Intronic
1102964261 12:117113804-117113826 TGGGGAGGGTCCCAGGAGCAGGG + Intergenic
1103210535 12:119162888-119162910 AGGACAGGGTCCCAGGATGCTGG - Exonic
1103611909 12:122129269-122129291 TGGGCAGAGTCCCTGGTTCAGGG + Intronic
1103735091 12:123056056-123056078 TGGGCAGTGTTCTAGGATCCAGG - Intronic
1103897999 12:124286554-124286576 CGGGCAGCGTGCCAGGAGCCTGG + Intronic
1104141093 12:125986170-125986192 TGGGCAGAGCCACAGGAACCAGG + Intergenic
1107028380 13:35826105-35826127 TGGGCAGTGTCTCATGGGCCAGG - Intronic
1108841876 13:54627915-54627937 TCGGCAGCTTCCCAGGATCTTGG - Intergenic
1108923427 13:55706150-55706172 TGGGCAATGTGCCAGGTTCAGGG + Intergenic
1110571257 13:77007182-77007204 TGGGAAGTGTCCAAGCATCTTGG - Exonic
1114265086 14:21069194-21069216 TGGGGGGTCTCCCAGGAGCCCGG - Intronic
1115105412 14:29755659-29755681 AGGGCAGTGACCCATGAGCCAGG - Intronic
1116448230 14:45037084-45037106 TTGGCTATGTCCCAGGATTCAGG - Intronic
1117986880 14:61395522-61395544 AGGGCATTGTCCTAGGATCCTGG + Intronic
1119259880 14:73231847-73231869 TGAGAAGTGTCCCAGGAGCATGG + Intergenic
1120750229 14:88190560-88190582 TGGGTAGAGTCCCAGGCTACAGG + Intronic
1121435823 14:93918759-93918781 TGCCAAGTGTCCCTGGATCCAGG - Intergenic
1121510023 14:94505611-94505633 TGGACACTGACCCAGAATCCAGG + Intronic
1121583596 14:95048122-95048144 TGAGCAGTGTCCATGGATCCTGG - Intergenic
1121726702 14:96157529-96157551 TGGGCAGTGGCCCAGGATGCAGG + Intergenic
1122634804 14:103124840-103124862 TGGGCAGAGTCCCACACTCCTGG - Intronic
1122890488 14:104729937-104729959 TGGGCAGAGGCCCACGAACCTGG + Exonic
1123020641 14:105396278-105396300 TGGGGTGTGCCCCAGGCTCCTGG - Exonic
1126574198 15:50182076-50182098 TGGGAAGTGGCCGAGGCTCCTGG + Intronic
1127256963 15:57300716-57300738 GGGGCGTTTTCCCAGGATCCAGG + Intergenic
1127410192 15:58697675-58697697 TGGGCAGATTCTCAGGCTCCTGG - Intronic
1130095699 15:80854253-80854275 TGAGCTGTGGCCCAGGATGCTGG - Intronic
1130938851 15:88491351-88491373 TTGGCTGTGTTCCAGGAGCCAGG + Intergenic
1132147178 15:99435963-99435985 TGGGCAGATTCCCAGATTCCAGG + Intergenic
1133350649 16:5098328-5098350 TGGGGAGGGGCCCAGGGTCCGGG + Intergenic
1133441459 16:5824394-5824416 CAGACAGTGTCCCAGTATCCAGG + Intergenic
1133547071 16:6817897-6817919 TGGGCAATGGCCCAGGAACAGGG - Intronic
1133706880 16:8363343-8363365 TATGCAGTGGCCCAGGGTCCAGG - Intergenic
1133858035 16:9567920-9567942 GGGGCAGGGCCCCAGGAGCCAGG - Intergenic
1134223989 16:12377509-12377531 GGGGCAGTCTCCCAGGCTCCTGG + Intronic
1134682624 16:16137007-16137029 TGGACAGAGCTCCAGGATCCTGG - Intronic
1134683344 16:16141826-16141848 TTGGCAGTGTCCCAGGGCCCTGG + Exonic
1135413252 16:22250705-22250727 TGGGCAGGGCCCCAAGAGCCAGG - Intronic
1136225656 16:28858605-28858627 TGGTCTTTGTCCCAGGTTCCTGG - Intronic
1136427463 16:30178639-30178661 TGGGCACAGTGCCAGGAACCAGG - Intergenic
1136477157 16:30520559-30520581 TGGGCACTGTCCCAGGCACAGGG + Intronic
1136587766 16:31198706-31198728 TGGGATGTGTCCCAAGATGCTGG + Intergenic
1138866942 16:60833181-60833203 GGGGCAGTGTCACTGCATCCCGG - Intergenic
1139955347 16:70690531-70690553 TGGGGAGTGGCCCAGAAGCCAGG + Intronic
1139984082 16:70883340-70883362 TGGGCTGTGGCACAGGACCCAGG - Intronic
1141067195 16:80923722-80923744 CAGGCACTGTCCCAGGATCTGGG + Intergenic
1141564324 16:84891274-84891296 GGGGCCGTGTCCCAGGAGGCAGG - Intronic
1142065903 16:88062639-88062661 AGGCCAGTGTCCCTGGAGCCTGG + Intronic
1143496883 17:7317539-7317561 TGGTTAGTGTCCCAGCCTCCAGG + Exonic
1143771815 17:9173796-9173818 GGGGCAATGTCCCGGGATTCAGG + Intronic
1145404017 17:22570111-22570133 GAGGTAGTGTCCCAGGCTCCAGG + Intergenic
1145722883 17:27089651-27089673 AAGGTAGTGTCCCAGGCTCCAGG - Intergenic
1145815002 17:27789103-27789125 TGGCCAGTGGCCCAGGCACCTGG - Intronic
1145999517 17:29122847-29122869 TGGGCACTGTCCCCCGGTCCGGG - Intronic
1146518208 17:33506055-33506077 AGGGCAGAGTCCTAGGATACTGG + Intronic
1149495612 17:57115559-57115581 TGGGCAGCCACCCAGGATCAAGG - Intronic
1150389408 17:64781718-64781740 CCGGGAGTGGCCCAGGATCCCGG - Intergenic
1150494306 17:65595425-65595447 TGGACAGAGTCACATGATCCAGG + Intronic
1150790997 17:68200071-68200093 TTGCCAGTCTCCCAGGAGCCTGG + Intergenic
1152358594 17:79819093-79819115 TGGGCCGTGTGCCAGGAGCCTGG + Intergenic
1153827627 18:8890970-8890992 TGGGCTTTGTCCCTGGTTCCTGG + Intergenic
1154378505 18:13828588-13828610 TGGGATGTGTCTCAGGAGCCTGG + Intergenic
1155332511 18:24732263-24732285 TGGCCTGTGTCCCCAGATCCTGG - Intergenic
1156470679 18:37375692-37375714 TGGGCAGTGGTACAGGATACTGG - Intronic
1158512758 18:58106175-58106197 TGGGCAGTGTCCCAGGATCCTGG - Intronic
1160680736 19:410795-410817 TGGACAGATCCCCAGGATCCGGG - Intergenic
1160680761 19:410869-410891 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680776 19:410906-410928 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680791 19:410943-410965 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680806 19:410980-411002 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680821 19:411017-411039 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680836 19:411054-411076 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680864 19:411128-411150 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680879 19:411165-411187 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680894 19:411202-411224 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680906 19:411239-411261 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680921 19:411276-411298 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160680933 19:411313-411335 TGGACAGACCCCCAGGATCCGGG - Intergenic
1160785684 19:899364-899386 TGGCCAGGGTCCCAGGGGCCTGG - Intronic
1161477494 19:4494543-4494565 GAGGCAGTATCCCAGGTTCCGGG + Intronic
1162433737 19:10644393-10644415 TCAGCACTGTCCCAGGATCCTGG + Exonic
1162913433 19:13862071-13862093 TGGCCACTGGGCCAGGATCCAGG + Intronic
1163550551 19:17964388-17964410 TGGGCAGTGTCTAAGGGTCTGGG - Intronic
1164692810 19:30223524-30223546 AGGGCAGGGTCCGAGGATGCTGG + Intergenic
1165076130 19:33280950-33280972 TGATCAGTGACCCTGGATCCTGG - Intergenic
1168465464 19:56597807-56597829 TGGGCAGATTCCCAGGAACAGGG + Intronic
1202696840 1_KI270712v1_random:132100-132122 TGGCCAGTGTCCCAGGGATCAGG + Intergenic
1202699663 1_KI270712v1_random:154765-154787 TGGGCACTGCCTCAGGCTCCTGG + Intergenic
925969783 2:9098342-9098364 TGGACAAATTCCCAGGATCCTGG - Intergenic
926130092 2:10297494-10297516 CGGGCAGTGTCCCAGGACCCCGG + Intergenic
926624811 2:15082326-15082348 TGAGCATTGTGCCAGGAGCCAGG + Intergenic
927250674 2:20992627-20992649 TGGGCAGTGTGCCGGGCTCTGGG + Intergenic
927839442 2:26429960-26429982 TGGGCACTGTTCCAGGGGCCTGG + Intronic
929597689 2:43186679-43186701 GGGGCAGCCTCCCAGGACCCCGG + Intergenic
931591443 2:63887972-63887994 TGGGCAGTGTTCTAGGTTCTAGG + Intronic
931859717 2:66342097-66342119 TAAGAAGAGTCCCAGGATCCTGG - Intergenic
933758620 2:85659851-85659873 TGGGGAGTCACCCAGGACCCGGG - Intronic
933877541 2:86633569-86633591 TGGGCAGGGTCCCAGGAACCAGG + Intronic
934170607 2:89538253-89538275 TGGGCACTGCCTCAGGCTCCTGG + Intergenic
934211058 2:89979043-89979065 TGGGCTGGGACCCAGGAGCCCGG - Intergenic
934277996 2:91589114-91589136 TGGCCAGTGTCCCAGGGATCAGG + Intergenic
934280909 2:91612573-91612595 TGGGCACTGCCTCAGGCTCCTGG + Intergenic
934734319 2:96681406-96681428 TTGGCAGTGTCCCAGGTAACTGG + Intergenic
934734458 2:96682642-96682664 TTGGCAGTGTCCCAGGTAACTGG - Intergenic
934936946 2:98472479-98472501 TGGCAAGTGTCCAAGGAACCAGG + Intronic
936010022 2:108919688-108919710 TGCCCAGTGTCCCAGGCTCTGGG + Intronic
938164196 2:129011779-129011801 TGTCCTGTGTCCCAGGCTCCTGG - Intergenic
939823820 2:146989732-146989754 GGGGCAGTGTCCTAGCAACCTGG - Intergenic
940092485 2:149936518-149936540 TGGGGAGTGTTCCAGGATGGAGG + Intergenic
942046815 2:172104034-172104056 TGGGCAGTGTGCGAGGTTGCGGG + Intergenic
943818556 2:192288529-192288551 TGGGCAGTCTTCCAAGTTCCTGG + Intergenic
946375343 2:219305135-219305157 TGTTCAGTGTCCCAGAAGCCAGG - Intronic
947083549 2:226425386-226425408 TTGACAGTGTCCCAGTATCTGGG - Intergenic
947220332 2:227785665-227785687 TGGTCAGAATTCCAGGATCCCGG - Intergenic
947626273 2:231621226-231621248 TGGGGAGTGTCCGAGGGCCCTGG + Intergenic
948429610 2:237911377-237911399 GAGGCAGTGGCCCTGGATCCAGG - Intronic
948528336 2:238587258-238587280 CGGGCAGGGTCCCAGGGACCAGG + Intergenic
948621960 2:239241037-239241059 TGTGCAGTTTCCTAGGATCACGG + Intronic
948803792 2:240444391-240444413 TGGACAGTGCCGCAGGGTCCTGG - Intronic
948981274 2:241496144-241496166 GAGGCAGTGTCTCAGGGTCCCGG - Intronic
949045670 2:241871733-241871755 TGGGCCGAGTCCCAGGTCCCCGG - Exonic
1168839880 20:903177-903199 TGGGCAGAGACCCAGGAACTGGG - Intronic
1169471412 20:5888805-5888827 TGGGCAGTCTCTCAGTCTCCAGG + Intergenic
1169741899 20:8903824-8903846 TGGGATGGGTTCCAGGATCCAGG - Intronic
1172003209 20:31797887-31797909 TGGGCAGTGTGCTAGAATACTGG + Intronic
1172134683 20:32679067-32679089 TGGACACTGTCCCAGGATGGCGG - Intergenic
1172252466 20:33489794-33489816 AGGGCAGTGGCCCAGGCTCGGGG - Intergenic
1174686931 20:52465164-52465186 TAGGCAGTGTCCCATGCTCCAGG - Intergenic
1175082525 20:56433064-56433086 TGGACTGCGTCCCATGATCCAGG - Intronic
1176093849 20:63330604-63330626 TGTGCAGAGACCCAGGATGCGGG + Intronic
1178753861 21:35329048-35329070 TGGGCACTGTGCCAGGAGCTGGG + Intronic
1178760345 21:35396222-35396244 TGGGTAGGGTCCCAGGTTCATGG - Intronic
1178953800 21:37006313-37006335 CGGGAAGTGACCCAGGAACCCGG - Intronic
1179457284 21:41508194-41508216 GAGGCGGTGTCCCAGGGTCCAGG + Intronic
1179632121 21:42685090-42685112 TGGACAGTTTCCCCGGCTCCTGG - Intronic
1179799719 21:43805338-43805360 TGGGCAGTGTCCCCTGGGCCTGG + Intergenic
1181414451 22:22749292-22749314 TGGGCTGTGACTCAGGGTCCTGG - Intronic
1181602682 22:23961504-23961526 TGGGCAGGGTCCCTGGCACCGGG - Intergenic
1181605832 22:23979803-23979825 TGGGCAGGGTCCCTGGCACCGGG + Intronic
1183248364 22:36711041-36711063 TGGGCAAGGGACCAGGATCCAGG - Intergenic
1183420876 22:37710568-37710590 TGGGTAGAGTCCCAGGGCCCAGG + Intronic
1184609124 22:45591144-45591166 GGGGCAGTGGCCCAGGGTCTGGG + Intronic
1184857298 22:47153452-47153474 TGGGCGGTGACCCAGGGGCCAGG + Intronic
1184882930 22:47322973-47322995 TGGGAGGTTTCCCAGGAGCCTGG + Intergenic
1184953270 22:47861320-47861342 TGAGGAGTTTCCCAGGATGCAGG + Intergenic
1184954758 22:47878520-47878542 TGGGCTGTGTCCCAGAGACCTGG - Intergenic
949724966 3:7033764-7033786 TGGGGAGTTTCCCAGGATGCGGG - Intronic
949844188 3:8353362-8353384 TGGGCTGAGTACCAGGGTCCTGG - Intergenic
950011956 3:9730579-9730601 TGGGCTTTGTCCCAGAACCCTGG + Intergenic
950577980 3:13844487-13844509 TGAGCAGCATCCCAGGCTCCTGG - Intronic
950668124 3:14509461-14509483 GGGGCAGTGCCCCAGTACCCTGG - Intronic
953231536 3:41069538-41069560 TGAGGAGTTTCCCAGGATGCTGG - Intergenic
953342892 3:42150355-42150377 TGGGCGGGGTCTCAGGTTCCTGG + Intronic
953850653 3:46463658-46463680 TGGGCTGTGGTCCAGGATTCTGG - Intronic
953896516 3:46807384-46807406 TGGGGAAAGTCCCAGGCTCCAGG - Intronic
954218521 3:49138031-49138053 TGGGCAGGGTCCCAGGTTGGAGG + Intergenic
954242200 3:49302754-49302776 AGGGCAGTGGCCCAGGTTCCAGG - Intronic
954406462 3:50348029-50348051 TTGGCAGTGCCCCATGATCCAGG + Intronic
954775807 3:53017424-53017446 TAGGTACTGTTCCAGGATCCAGG + Intronic
954862506 3:53702571-53702593 AGGGCAGTGGCTCAGGATGCAGG + Intronic
957054916 3:75435675-75435697 TGGGGAGGGGCCCAGGGTCCAGG + Intergenic
961299921 3:125915999-125916021 TGGGGAGGGGCCCAGGGTCCGGG - Intergenic
961620765 3:128222833-128222855 TGGTCTTTGTCCCAGGTTCCTGG + Intronic
961888588 3:130112074-130112096 TGGGGAGGGGCCCAGGGTCCGGG + Intronic
965378498 3:167957497-167957519 TGGGAAGTGTCTCAGAATGCTGG - Intergenic
966918492 3:184597663-184597685 TGGGGTGAGGCCCAGGATCCTGG + Intronic
968997732 4:3955981-3956003 TGGGGAGGGGCCCAGGGTCCGGG + Intergenic
969032743 4:4227222-4227244 TGGCCAGTGTCCCAGGGATCAGG - Intergenic
969392800 4:6902209-6902231 TGGGCTGGGTGCCAGGGTCCAGG + Intergenic
969536644 4:7760412-7760434 TGGACAGTGGCCCATGCTCCTGG + Exonic
969756274 4:9152671-9152693 TGGGGAGGGGCCCAGGGTCCGGG - Intergenic
969816602 4:9691869-9691891 TGGGGAGGGGCCCAGGGTCCGGG - Intergenic
969842046 4:9889844-9889866 GGGGCAGAAGCCCAGGATCCGGG + Intronic
975484765 4:74923496-74923518 TGCTCTGTCTCCCAGGATCCAGG - Intergenic
975947630 4:79726857-79726879 TGGGCAATGTGCCAGGAACTAGG - Intergenic
986233127 5:5885080-5885102 TGGGCAAGATCCCAAGATCCAGG + Intergenic
986313821 5:6572993-6573015 TGGGCAGGGTCCCTGGCTCAGGG + Intergenic
991548086 5:67805902-67805924 GAGGCAGTCTCCCAGGATCTGGG + Intergenic
993233852 5:85277300-85277322 TTGGCTGTGTCCCAAGATTCTGG - Intergenic
994124390 5:96153238-96153260 AGGGCAGGGTCCCAGACTCCAGG - Intergenic
996078495 5:119227158-119227180 TGGTCTTTGTCCCTGGATCCTGG - Intronic
996633857 5:125667184-125667206 TGGCCAGAGACTCAGGATCCAGG + Intergenic
998460795 5:142308617-142308639 TGGGCAGTGTCTGGGGATCCTGG + Intergenic
998888576 5:146721503-146721525 TTGGGAGAGTGCCAGGATCCTGG - Intronic
1000528885 5:162393525-162393547 TGGGCAGTGTCCCACAAGACTGG - Intergenic
1001698888 5:173692391-173692413 TGGGCAGTGGCCCAGGAACAAGG + Intergenic
1002329273 5:178430293-178430315 TGGGCAGAGACCCAGGAACCTGG - Intronic
1002400100 5:178986790-178986812 TGGGCATGGGCCCAGGATCCCGG - Intronic
1003188780 6:3854997-3855019 TGGTCTTTGTCCCAGGTTCCTGG + Intergenic
1004430670 6:15539625-15539647 AGGTCAGTGTCTCAGGACCCTGG + Intronic
1005926964 6:30452468-30452490 TGGGCAGGGTAGCAGGTTCCAGG - Intergenic
1005928708 6:30465192-30465214 TGGGCAGGGTAGCAGGTTCCAGG - Intergenic
1006193085 6:32221228-32221250 TGGGCAGTGGCACTGGATCTGGG + Exonic
1007106315 6:39285508-39285530 TAGGCAGTGTCTGAGGAACCAGG + Intergenic
1007324009 6:41046696-41046718 TGGGCAGTGTCCCAAGCCCTGGG + Intronic
1007513413 6:42391947-42391969 TGGGCTGTGTCTCAGGAACTGGG + Intronic
1007931071 6:45691015-45691037 TGGTCAGTGCCCCAGTATCCAGG - Intergenic
1009632874 6:66221796-66221818 TGGGGAGTGGCTCAGAATCCTGG + Intergenic
1009992700 6:70863571-70863593 TGGCCAGTGTCCCAGGGGCAGGG - Intronic
1018792170 6:167157186-167157208 TGGGCTGTTTCTCAGGCTCCCGG + Exonic
1018903847 6:168064043-168064065 TGGGCAGGTTCCCAAGAGCCAGG - Intronic
1018987804 6:168650813-168650835 TTGGCAGGGTCCCAGAATTCTGG + Intronic
1019371355 7:663601-663623 ACGGCTGTGTCCCAGGGTCCTGG + Intronic
1019564722 7:1673644-1673666 TGGGCTTTGTCCCAGGCTCCAGG - Intergenic
1019610850 7:1935957-1935979 TGGGCACTGCCCCACGCTCCTGG - Intronic
1021574834 7:22097396-22097418 AGGGCAGAGTCCCATGATCTGGG - Intergenic
1022456427 7:30562508-30562530 GGGCCACTGTCCCAGGATGCTGG + Intergenic
1022485682 7:30775783-30775805 TGTTCTGTGTCCCAGGTTCCTGG - Intronic
1023999806 7:45182887-45182909 TGGGCTGAGACCCTGGATCCTGG + Intronic
1024189457 7:46991004-46991026 TGGCCAGGGTCCAAGGATACTGG + Intergenic
1024393479 7:48840803-48840825 TGGTCTGTGTCCCAGGAACTGGG - Intergenic
1024635810 7:51289383-51289405 AGTGCAGTGACACAGGATCCAGG - Intronic
1026264596 7:68785221-68785243 TGGGCAAAGTGCCAGGCTCCCGG - Intergenic
1027219080 7:76202467-76202489 TGGACAGAGGCCCAGCATCCAGG - Intronic
1029345554 7:99976064-99976086 TGGGCAGGGCCCCAGGACCCAGG - Exonic
1029346232 7:99980707-99980729 TGGGCATGGCCCCAGGACCCAGG + Intergenic
1029558945 7:101289808-101289830 TGGGCATGGCCCCAGGACCCAGG - Intergenic
1029597868 7:101547198-101547220 TGGCAGGTGTCCCAGGACCCCGG + Exonic
1029658822 7:101945518-101945540 TGGGCACGGTCCCAGGTGCCGGG + Intronic
1029745868 7:102515616-102515638 TGGGCAGAGTTCCTGGCTCCTGG - Intronic
1029763806 7:102614595-102614617 TGGGCAGAGTTCCTGGCTCCTGG - Intronic
1030535678 7:110763420-110763442 TGGGCAGTGTACTAGGGTCCAGG + Intronic
1034051775 7:147991118-147991140 TGGTCTTTGTCCCAGGTTCCTGG - Intronic
1035016614 7:155772176-155772198 TGCTCAGTGCTCCAGGATCCTGG - Intronic
1037630689 8:20653041-20653063 TGGGCAGTGGCCAAGTATCCTGG + Intergenic
1038676075 8:29624121-29624143 GTGGCAGTGTCCCAGGGGCCTGG - Intergenic
1040697931 8:50024570-50024592 TTGGCAGTGTCCAAGGTTTCAGG - Intronic
1041442275 8:57910128-57910150 TGAGCAGTGTTCCAGGAACAGGG - Intergenic
1043518973 8:81024382-81024404 GGGGCCGTGTGCCAGGAGCCCGG - Intronic
1044707799 8:95025162-95025184 TGGTCAGTGCCCCAGGCGCCCGG - Exonic
1046397258 8:113656610-113656632 TGGCAAATGTCCCAGGACCCTGG - Intergenic
1048941526 8:139404471-139404493 TGGTCAGTGTCCAGGGAGCCGGG + Intergenic
1049259089 8:141629293-141629315 TGGGGAGCCTCCTAGGATCCTGG + Intergenic
1049356937 8:142193653-142193675 TAGGCTGTGATCCAGGATCCAGG - Intergenic
1049374455 8:142282323-142282345 TGGGCAGAGGCCCAGGATGAAGG + Intronic
1049435954 8:142586341-142586363 TGGCCATTGTCCCAGGACCAGGG + Intergenic
1049799397 8:144510756-144510778 TCAGCAGTGCCCCAGGCTCCTGG - Intronic
1049909199 9:249130-249152 TGGGGGGTTTCCCAGGATCTTGG + Intronic
1049909202 9:249141-249163 TTGGCACTGGCCCAAGATCCTGG - Intronic
1051368166 9:16335876-16335898 TGGGCAGTGTGGCAGGAGTCAGG + Intergenic
1056563248 9:87751143-87751165 TGGGCAAAGTGCCAGGGTCCCGG + Intergenic
1056587715 9:87939124-87939146 GAGGTAGTGTCCCAGGCTCCAGG + Intergenic
1056609155 9:88113815-88113837 GAGGTAGTGTCCCAGGCTCCAGG - Intergenic
1059443817 9:114325847-114325869 TAAGCCCTGTCCCAGGATCCTGG - Intronic
1059445023 9:114332624-114332646 TAAGCCCTGTCCCAGGATCCTGG - Intronic
1061861693 9:133471746-133471768 AGGGCCGTGTCCCTGGATGCAGG + Exonic
1061886531 9:133593802-133593824 TGGGCAGTGTCTGAGGTTCGGGG - Intergenic
1062057374 9:134475566-134475588 TGGGCCGTGTCCCGGGAGGCGGG + Intergenic
1062094524 9:134695972-134695994 AGGGCAGAGGCCCAGGATCCAGG - Intronic
1185501529 X:600277-600299 TGGGGAGTGTCTCAGGACTCTGG - Intergenic
1185544025 X:927106-927128 AGGTCACTTTCCCAGGATCCGGG + Intergenic
1187950363 X:24465076-24465098 TGGGCTGAGTCCCATGAGCCAGG + Intergenic
1189142839 X:38624851-38624873 TGGGGTGTGTCCCAGGAATCAGG + Intronic
1190175568 X:48146343-48146365 TGGGCAGAGTCCCTGGATGAAGG - Intergenic
1190182856 X:48208235-48208257 TGGGCAGAGTCCCTGGATGAAGG - Intronic
1190192339 X:48287808-48287830 TGGGCAGAGTCCCTGGATGAAGG + Intergenic
1190201751 X:48367678-48367700 TGGGCAGAGTCCCTGGATGAAGG + Intergenic
1190208788 X:48427733-48427755 TGGGCAGAGTCCCTGGATGAAGG - Intergenic
1190668588 X:52718215-52718237 TGGGCAGAGTCCCTGGATGAAGG + Intergenic
1190670829 X:52740189-52740211 TGGGCAGAGTCCCTGGATGAAGG - Intergenic
1192206547 X:69100469-69100491 TGGGCCTTGGCCCAGGATTCTGG - Intergenic
1192330687 X:70173093-70173115 TGAGGAGTTTCCCAGGATGCTGG - Intergenic
1193966578 X:87994678-87994700 TGGGCTGCATCCCAGGATACAGG - Intergenic
1198393072 X:136196006-136196028 TGGGCAGTGTTCTAGGCTCTGGG + Intronic
1199585517 X:149412379-149412401 TGTGCAGTGTAGCAGGAACCTGG - Intergenic
1200161714 X:154013059-154013081 GGGGGAGTGGCCCAGGATCCCGG - Exonic
1201061304 Y:10049202-10049224 CAGGCAGTCTCCCAGGCTCCTGG - Intergenic