ID: 1158512760

View in Genome Browser
Species Human (GRCh38)
Location 18:58106189-58106211
Sequence CACTGCCCAAATCAACTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158512751_1158512760 16 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 92
1158512752_1158512760 15 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 92
1158512756_1158512760 0 Left 1158512756 18:58106166-58106188 CCGTGCTGCCCAGGATCCTGGGA 0: 1
1: 0
2: 3
3: 43
4: 475
Right 1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 92
1158512758_1158512760 -9 Left 1158512758 18:58106175-58106197 CCAGGATCCTGGGACACTGCCCA 0: 1
1: 0
2: 6
3: 28
4: 321
Right 1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 92
1158512757_1158512760 -8 Left 1158512757 18:58106174-58106196 CCCAGGATCCTGGGACACTGCCC 0: 1
1: 0
2: 0
3: 22
4: 282
Right 1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158512760 Original CRISPR CACTGCCCAAATCAACTGTC AGG Intronic
900907723 1:5572478-5572500 CACTGCCCAAGACAACTTCCTGG - Intergenic
901148629 1:7085634-7085656 CTCTGCCCACATAACCTGTCAGG - Intronic
914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG + Intergenic
915888179 1:159745788-159745810 CTCAGGCCAAATAAACTGTCTGG + Intergenic
920378334 1:205521508-205521530 CACTGAACAAATGAACTGGCCGG - Intronic
921653457 1:217706277-217706299 CACTGCCCAAAGCAATTTACAGG - Intronic
1067710574 10:48648358-48648380 CACTGCCCCAATCAACTGCAAGG - Intronic
1067752312 10:48979689-48979711 CACTGCCAGAATCAACTGAATGG - Intronic
1075140831 10:119833665-119833687 CACTGACCAAATAAAATGTCTGG + Intronic
1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG + Intronic
1087746396 11:101952534-101952556 CACTGACCAAATCTAATCTCTGG - Intronic
1087970673 11:104478016-104478038 CACTGCCAGAATCAACTATTTGG + Intergenic
1090430218 11:126639718-126639740 CACTTTCCAACTCATCTGTCTGG + Intronic
1096814287 12:54191861-54191883 CACTGCACAAAACAAAGGTCGGG + Intergenic
1097867297 12:64569398-64569420 CACTGCACAAAGCAGCTGGCTGG - Intergenic
1102798567 12:115711267-115711289 CACTGATCAAATCAAGTTTCTGG + Intergenic
1105880499 13:24601674-24601696 TACTGCCCAAAGCAATTGACAGG - Intergenic
1107964579 13:45587573-45587595 CTCTGCCCAAAACAACTGTGAGG - Intronic
1108228480 13:48315110-48315132 CACTGCCCAAAGCAATTTACAGG - Intronic
1108987179 13:56606774-56606796 CACTGCACAGATTAACTGTTGGG + Intergenic
1115334268 14:32229484-32229506 CACTGCCCAAATCAAAGACCTGG - Intergenic
1117536277 14:56705975-56705997 CATCCCCCAAATCAACTTTCAGG + Intronic
1120591711 14:86382280-86382302 CCCTGCCCTAATTAACTGACTGG + Intergenic
1122642510 14:103168401-103168423 CACTGTCCAAGTCAACTGAGTGG - Intergenic
1129661834 15:77557100-77557122 CACTCCCCAACCCAACTGGCAGG - Intergenic
1136546695 16:30958505-30958527 CACCTCCCAACTCTACTGTCAGG - Intronic
1137274903 16:46926994-46927016 CTCTGCCCAAAGCCACTGCCGGG - Exonic
1141004627 16:80340363-80340385 CACAGCCCAAATCCTCTTTCAGG - Intergenic
1144543996 17:16175324-16175346 CACTGCACAACACAACAGTCTGG + Intronic
1154235993 18:12606289-12606311 CAGTGCCTAAAACAACTGTCTGG + Intronic
1156816848 18:41321663-41321685 CACTGCCCCAATCATCTTTTGGG - Intergenic
1157707222 18:49817703-49817725 CAATCCCCAAATCAAGGGTCAGG - Intronic
1157924767 18:51751680-51751702 CACTGGCCAAATCAAGTCACGGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160586805 18:79917682-79917704 CACTGCCCAACCCAACAGTGAGG + Intronic
1161195213 19:2982835-2982857 CTCTGTCCAAAGCAACTGACCGG - Intronic
1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG + Intronic
1164080372 19:21857120-21857142 CACTGCCCACAGCCACTGGCTGG + Intergenic
928214531 2:29350348-29350370 CACTGGCCACAACAAATGTCTGG - Intronic
930031773 2:47062540-47062562 CACTGCCCTAATCAAGTTTCTGG - Intronic
932602554 2:73138470-73138492 CACTTCCGAAACCAAATGTCTGG + Intronic
933512550 2:83259466-83259488 TACTGCCCAAAGCAACTTACAGG + Intergenic
937771421 2:125724653-125724675 CATTGTCCAAATCTAGTGTCTGG + Intergenic
938086558 2:128405792-128405814 CACTGCCCAAATCACATTGCTGG - Intergenic
939075203 2:137593010-137593032 CACAGCCCAAAAGAACTGTGTGG - Intronic
941704847 2:168647104-168647126 CACTGCCCAAATCAATTTACCGG - Intronic
941998439 2:171623452-171623474 CATTGCCCTAAACAATTGTCAGG + Intergenic
944310276 2:198225399-198225421 CACTGTCCAAATAACTTGTCTGG - Intronic
946313077 2:218893515-218893537 CCCAGCCCAACTGAACTGTCTGG - Exonic
947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG + Intronic
947579597 2:231306813-231306835 CACTGCCCAGATCCTCTGTGTGG - Intronic
1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG + Intronic
1169623675 20:7538722-7538744 CCCTGCCCAAAGCTAGTGTCTGG + Intergenic
1169786823 20:9368466-9368488 CCCTGCCCACAACTACTGTCTGG - Intronic
1172744771 20:37198131-37198153 CACTTCCCGGATCACCTGTCTGG - Intronic
1174784689 20:53421506-53421528 CACTGCCAAAATCGAGTGGCTGG + Intronic
1177724786 21:24953283-24953305 CACCGCACCAATCAACTTTCGGG - Intergenic
1177949263 21:27513234-27513256 CAAAGCCCACATCAACTGCCAGG + Intergenic
1182045703 22:27272431-27272453 CACTGCCCCAACCAGCTGTGTGG + Intergenic
951283341 3:20779595-20779617 CCCTGCTTAAAGCAACTGTCTGG - Intergenic
952651618 3:35734478-35734500 CAGTGACAAAATCAACTGTTTGG - Intronic
960499591 3:118420064-118420086 CAATACCCAAATCATATGTCAGG + Intergenic
962302590 3:134255921-134255943 CACTGCCCAATAGAAATGTCAGG - Intergenic
964134149 3:153325620-153325642 TACTGCCCAAAGCAACTTGCAGG - Intergenic
965430341 3:168579165-168579187 CACTTTCCTAATCAGCTGTCAGG - Intergenic
970450379 4:16160542-16160564 CACTGACCAAATGATCTCTCAGG - Exonic
970615029 4:17760960-17760982 GACTGTGCAAATCAACTGTTGGG - Intronic
978515777 4:109567213-109567235 CACTGCCCAAATCACATTTCTGG + Intronic
979270676 4:118756991-118757013 CACAGCCCAAAACAAATTTCAGG - Intronic
980130727 4:128813100-128813122 CACTACCTAAATCAGCTTTCAGG - Intronic
981575531 4:146200605-146200627 CACTGCACAAAGCAACTTGCAGG + Intergenic
982727239 4:158918714-158918736 TACTGGCCACATCAACTGTGGGG + Intronic
985334860 4:188881378-188881400 CACTGGCCAATTCCACTGTGAGG - Intergenic
987230812 5:15891953-15891975 CACTGCCCAAAGCACCAGGCAGG + Intronic
987844586 5:23266022-23266044 TACTGCCCATATCAATTATCAGG - Intergenic
992918400 5:81483991-81484013 CACTGCCCAATAGAACTTTCTGG - Intronic
995098285 5:108266477-108266499 CAGTTATCAAATCAACTGTCAGG + Intronic
998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG + Intronic
1008758808 6:54829337-54829359 CACTGCCTGAATAAATTGTCTGG - Intergenic
1012286360 6:97393806-97393828 CACTCCTCAAATCTACTTTCAGG - Intergenic
1013599244 6:111688905-111688927 GACTGCCCAGATCCACTGACTGG + Intronic
1014940453 6:127432236-127432258 GCTTGCCCAAATCAACTGTTTGG - Intergenic
1015179430 6:130345887-130345909 CTGTTCCCAAATTAACTGTCAGG + Intronic
1015685252 6:135851695-135851717 CAGTGCCCAGACCAACTGACTGG - Exonic
1017075568 6:150614579-150614601 CTTTGACCCAATCAACTGTCAGG - Intronic
1023837240 7:44075486-44075508 CACTGCCCAGTTCAGCTGACAGG - Intronic
1023877283 7:44293928-44293950 CACTGCCCAGACCCACTGCCAGG + Intronic
1034214545 7:149395016-149395038 CACTTCCCAACCCCACTGTCTGG + Intergenic
1034756111 7:153621301-153621323 CATTGCCCAGATGAATTGTCTGG + Intergenic
1037866753 8:22450247-22450269 CACTTTCCACATCAACTGTCTGG - Intronic
1038828020 8:31028096-31028118 AATTCCCCAAATTAACTGTCAGG + Intronic
1041968232 8:63705545-63705567 GCCTGCCCAGCTCAACTGTCAGG - Intergenic
1044543466 8:93433323-93433345 CATGCCCCAAATCTACTGTCAGG - Intergenic
1044931650 8:97257773-97257795 CACTGCCCAAATGCCCTTTCTGG + Intergenic
1048850667 8:138642390-138642412 CTCTGCCCAACGCAACTGCCTGG + Intronic
1052375164 9:27711032-27711054 CATTGCCCAAAACAAGGGTCTGG - Intergenic
1061485055 9:130916299-130916321 CACTGGCAAAATCAACTGAATGG - Intronic
1061994132 9:134175451-134175473 CTCTGCCCAAACCACCTCTCAGG - Intergenic
1187608936 X:20919306-20919328 CTCTGCCCAAATTTAGTGTCAGG + Intergenic
1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG + Intergenic
1199539673 X:148945113-148945135 CACTGCCCAAGCCAAGGGTCAGG - Intronic
1199599267 X:149532072-149532094 CACTGGGCAAATCAACTTTCTGG + Intronic
1202033319 Y:20602990-20603012 CACTGCCGAAATCAATTTACAGG - Intergenic