ID: 1158512761

View in Genome Browser
Species Human (GRCh38)
Location 18:58106193-58106215
Sequence GCCCAAATCAACTGTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158512751_1158512761 20 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 79
1158512757_1158512761 -4 Left 1158512757 18:58106174-58106196 CCCAGGATCCTGGGACACTGCCC 0: 1
1: 0
2: 0
3: 22
4: 282
Right 1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 79
1158512756_1158512761 4 Left 1158512756 18:58106166-58106188 CCGTGCTGCCCAGGATCCTGGGA 0: 1
1: 0
2: 3
3: 43
4: 475
Right 1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 79
1158512752_1158512761 19 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 79
1158512758_1158512761 -5 Left 1158512758 18:58106175-58106197 CCAGGATCCTGGGACACTGCCCA 0: 1
1: 0
2: 6
3: 28
4: 321
Right 1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158512761 Original CRISPR GCCCAAATCAACTGTCAGGC TGG Intronic
902654190 1:17856406-17856428 GCCCGAATCTACTCTCAGCCTGG - Intergenic
902937386 1:19774003-19774025 GCCCAACTCACCTGTGAGGCAGG - Intronic
909867233 1:80688177-80688199 GCCAAAATCAAGTATCAGCCAGG + Intergenic
914508408 1:148309168-148309190 GCCCAAAGCAGCGGCCAGGCTGG - Intergenic
915888181 1:159745792-159745814 GGCCAAATAAACTGTCTGGCGGG + Intergenic
1067052731 10:43032006-43032028 GCCTAAATCACATCTCAGGCAGG + Intergenic
1069754327 10:70764012-70764034 GCCCAAATGAAGTCACAGGCTGG - Intergenic
1069787546 10:70998349-70998371 GCACATGTCAACTGTGAGGCTGG - Intergenic
1071519672 10:86321654-86321676 CCCCAAATCAAATGTGAGGGTGG + Intronic
1074004409 10:109404822-109404844 ACCCAACTCAACAGGCAGGCTGG + Intergenic
1075721000 10:124587443-124587465 GCCCAAATCCACCCTGAGGCAGG + Intronic
1077828222 11:5833649-5833671 GCCCATATAAACTGACAGTCTGG - Intronic
1078643871 11:13120355-13120377 GCCCAAAGCTGGTGTCAGGCTGG + Intergenic
1080317741 11:30969456-30969478 GCCAAAATCAAGTGTCAGTGGGG - Intronic
1080671112 11:34378938-34378960 GCAAAAATCAACTTTAAGGCTGG - Intergenic
1083093526 11:60224519-60224541 GCCCAAATCAACTATCAGTAAGG - Intronic
1083100291 11:60297752-60297774 TCCCAAATCAACTGTCAGTAAGG + Intronic
1084358525 11:68654568-68654590 GCCCAGCTCATCTTTCAGGCAGG + Intergenic
1085270650 11:75267867-75267889 CCCCAAATCATCTGAAAGGCAGG + Intronic
1086458426 11:86982246-86982268 CCCCAAAACAAGAGTCAGGCTGG + Intergenic
1087401617 11:97674087-97674109 ACCCATATCAAATTTCAGGCAGG - Intergenic
1087586793 11:100131788-100131810 GCCTACCTCAACTGTAAGGCAGG - Intronic
1088926051 11:114304231-114304253 GTCCAAATCATCTGTCAAGAAGG + Intronic
1102497039 12:113327006-113327028 CCCAAAAGCAACAGTCAGGCTGG + Intronic
1103295830 12:119886124-119886146 GCCTAAATCAAATGGCAGGGAGG - Intergenic
1104973327 12:132541204-132541226 GTGCAAATCCACTGTCAGCCTGG + Intronic
1106242942 13:27924788-27924810 GCCCCATTCAACTGCCAGGGCGG - Exonic
1107964578 13:45587569-45587591 GCCCAAAACAACTGTGAGGTAGG - Intronic
1107979871 13:45724490-45724512 TCCCCAAGGAACTGTCAGGCTGG - Intergenic
1109814987 13:67569708-67569730 GCCAAAATCAACTGCCAGCAGGG + Intergenic
1111521712 13:89413342-89413364 CCCCAAATCAAAGGTCAGACAGG - Intergenic
1117669033 14:58087227-58087249 TCCTAAATGAACTGTCAAGCTGG - Intronic
1118473625 14:66097646-66097668 TCCCAAAACAAGTGGCAGGCAGG - Intergenic
1132630942 16:917146-917168 GCCCAAAGCCACTCTCATGCCGG + Intronic
1135962869 16:27012342-27012364 GCCACGATCAGCTGTCAGGCAGG - Intergenic
1142262064 16:89047746-89047768 GCCGAAGTCAACAGGCAGGCGGG + Intergenic
1149258989 17:54858645-54858667 GCCCACATCCACCTTCAGGCTGG - Intergenic
1151198387 17:72448459-72448481 GTCCAAATCAATTTTCACGCAGG + Intergenic
1153665374 18:7363523-7363545 TCCCAACTCAACTGTAAGGCAGG - Intergenic
1158512761 18:58106193-58106215 GCCCAAATCAACTGTCAGGCTGG + Intronic
1163560602 19:18017191-18017213 GCAGAAATTAACTGGCAGGCTGG + Intergenic
1166722234 19:45003122-45003144 GCCCATCTCAACTGGCAGGGAGG - Intronic
1167166085 19:47801584-47801606 GCTCAATTCAAATGACAGGCAGG + Exonic
1167175595 19:47861681-47861703 GCTCAATTCAAATGACAGGCAGG - Intergenic
927893380 2:26766135-26766157 CCCCACACCAGCTGTCAGGCAGG - Intronic
928036722 2:27831020-27831042 GCCAGCATCAACTGTCAAGCAGG + Intronic
934900782 2:98158366-98158388 GCCCACAACAGCTGGCAGGCTGG + Intronic
941998440 2:171623456-171623478 GCCCTAAACAATTGTCAGGTAGG + Intergenic
946651586 2:221897341-221897363 GCCCAAATCAACAGATAGGTGGG + Intergenic
947404977 2:229765925-229765947 GCCCAAGTGAACTCTCAGGAGGG + Intronic
947730379 2:232425636-232425658 ACCCAAAGCAACTGTTAGACAGG - Intergenic
947893811 2:233649536-233649558 AATCAAATCAACTATCAGGCTGG + Intronic
1170752175 20:19159829-19159851 GGCCAAATCCAGTGTCATGCAGG + Intergenic
1172971312 20:38874896-38874918 GCCCAAGGCAAATGTGAGGCAGG - Intronic
1178760353 21:35396254-35396276 GCCCAGATGACCTGTCAGGGAGG + Intronic
1179923822 21:44521800-44521822 GCCCACATCACCTGTCCAGCAGG + Intronic
1180181019 21:46118731-46118753 GCCCAGATGAACAGTCACGCTGG + Intronic
1184192721 22:42905740-42905762 GCCAAAATAAACTGCCCGGCTGG + Intronic
957975014 3:87432444-87432466 GCCCTGATCAAGAGTCAGGCGGG + Intergenic
959459237 3:106604378-106604400 TGCCAAATCAGCTGTCAGGCTGG + Intergenic
968463989 4:740869-740891 GCCCAAAGCCACCGGCAGGCAGG - Intronic
995486023 5:112640919-112640941 GCCCAAAGCAGCTCTGAGGCTGG + Intergenic
996270295 5:121596541-121596563 TCCCAATTCAAATGTGAGGCAGG + Intergenic
997863269 5:137438753-137438775 GCCAAAATGAACTGGCAGGCAGG + Intronic
1000233761 5:159338699-159338721 TCCCAAATCAACTGTCACAAAGG - Intergenic
1006597190 6:35202082-35202104 ACCCAAAAGAACAGTCAGGCTGG + Intergenic
1007608954 6:43136516-43136538 GCCCCAGTCAACTGCCAGACAGG - Intronic
1014940451 6:127432232-127432254 GCCCAAATCAACTGTTTGGGAGG - Intergenic
1015544294 6:134346195-134346217 TCTAAAATCAACTATCAGGCTGG + Intergenic
1015685251 6:135851691-135851713 GCCCAGACCAACTGACTGGCTGG - Exonic
1017043107 6:150323567-150323589 GTCCAAATCACTTGTGAGGCAGG - Intergenic
1018746866 6:166769040-166769062 TCCTAAATCAACAGCCAGGCCGG - Intronic
1024116795 7:46201858-46201880 ACCCATCTCAACAGTCAGGCAGG - Intergenic
1028163308 7:87510039-87510061 GCTCATATCAAGTGTCAGGAGGG - Intronic
1029209451 7:98894102-98894124 GCCCAAATAACCTGTCAGTTTGG - Intronic
1032253336 7:130276950-130276972 GCCCATTTCAGCTGTTAGGCTGG + Intronic
1036659254 8:10697529-10697551 GCCCACATCCACTGCCTGGCAGG + Intronic
1037711476 8:21358751-21358773 TCCCAGCTCAACAGTCAGGCAGG + Intergenic
1039462241 8:37754965-37754987 GCACACATAACCTGTCAGGCAGG - Exonic
1040418092 8:47214154-47214176 GCCCTAAACAACTGTCAGTCAGG + Intergenic
1040802832 8:51362705-51362727 GCCCTAAGCAACTGCCAGCCAGG - Intronic
1044790900 8:95845962-95845984 TCCCAATTCCTCTGTCAGGCAGG - Intergenic
1047905738 8:129471356-129471378 TCCCAGCTCAACAGTCAGGCAGG + Intergenic
1049819827 8:144626828-144626850 GCCCCACTCAAGTGTCAGGAGGG - Intergenic
1060536902 9:124397374-124397396 TCCCAAATAAACTCTCAGGAAGG + Intronic
1060904812 9:127295309-127295331 GCCCAGATGAACTCTAAGGCAGG - Intronic
1061014230 9:127972719-127972741 ACCCAAATCAGCTGGCTGGCAGG + Intronic
1061643042 9:131974757-131974779 TCCCAACTCACCTGTTAGGCAGG + Intronic
1186921284 X:14283544-14283566 GCCAAAATCATGTCTCAGGCCGG - Intergenic
1195299402 X:103512326-103512348 GCCCTGATCAACAGTAAGGCTGG + Intronic
1195935330 X:110120052-110120074 GCCCAATTCACCTGTCAGGAGGG - Intronic