ID: 1158512763

View in Genome Browser
Species Human (GRCh38)
Location 18:58106194-58106216
Sequence CCCAAATCAACTGTCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158512752_1158512763 20 Left 1158512752 18:58106151-58106173 CCTGTGTAGGGACATCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 121
1158512758_1158512763 -4 Left 1158512758 18:58106175-58106197 CCAGGATCCTGGGACACTGCCCA 0: 1
1: 0
2: 6
3: 28
4: 321
Right 1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 121
1158512756_1158512763 5 Left 1158512756 18:58106166-58106188 CCGTGCTGCCCAGGATCCTGGGA 0: 1
1: 0
2: 3
3: 43
4: 475
Right 1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 121
1158512751_1158512763 21 Left 1158512751 18:58106150-58106172 CCCTGTGTAGGGACATCCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 121
1158512757_1158512763 -3 Left 1158512757 18:58106174-58106196 CCCAGGATCCTGGGACACTGCCC 0: 1
1: 0
2: 0
3: 22
4: 282
Right 1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158512763 Original CRISPR CCCAAATCAACTGTCAGGCT GGG Intronic
901306664 1:8237827-8237849 CCCAAATCATCCGCCAGCCTTGG + Intergenic
903061930 1:20674852-20674874 CAAAAATCAATTGACAGGCTGGG + Intronic
904307940 1:29602289-29602311 CCCAAGTCCCCTGTCAGGATGGG + Intergenic
908340568 1:63174092-63174114 CCCAAATGATCTGTCCGCCTTGG - Intergenic
908745383 1:67371435-67371457 CCCTAATCAACTGTCAGTGTAGG + Intronic
914361065 1:146936882-146936904 CTCAAATGATCTGTCAGCCTTGG + Intergenic
914491522 1:148153750-148153772 CTCAAATGATCTGTCAGCCTTGG - Intergenic
915888182 1:159745793-159745815 GCCAAATAAACTGTCTGGCGGGG + Intergenic
922475839 1:225906490-225906512 GCCACATCAACTTTCAGGCCAGG + Intronic
922656674 1:227390741-227390763 CCCAAGCCAACTGGCATGCTGGG + Intergenic
923291294 1:232548761-232548783 CCCAGATCAACTGTGAGGACAGG + Intronic
1063350047 10:5346012-5346034 CCCAAATTAAATATCAGCCTAGG + Intergenic
1065195984 10:23266040-23266062 GCTAAATCAACTGCCTGGCTGGG + Intergenic
1069787545 10:70998348-70998370 CACATGTCAACTGTGAGGCTGGG - Intergenic
1070696099 10:78564284-78564306 CCCAAATAAGCTTTCTGGCTGGG - Intergenic
1071857216 10:89637613-89637635 CCCAGAGCAACTGTCAGTCCTGG - Intronic
1076179324 10:128394222-128394244 CTCAAATCAACTGTCATATTAGG - Intergenic
1076400870 10:130184363-130184385 CACAAATTAAGTGCCAGGCTGGG + Intronic
1076414759 10:130277760-130277782 CTCCAATCATCTGTCAGCCTGGG + Intergenic
1077651458 11:3976787-3976809 AAAAAAACAACTGTCAGGCTAGG - Intronic
1078643873 11:13120356-13120378 CCCAAAGCTGGTGTCAGGCTGGG + Intergenic
1080372993 11:31673622-31673644 TCAAAAACTACTGTCAGGCTGGG - Intronic
1080671111 11:34378937-34378959 CAAAAATCAACTTTAAGGCTGGG - Intergenic
1083093524 11:60224518-60224540 CCCAAATCAACTATCAGTAAGGG - Intronic
1085270652 11:75267868-75267890 CCCAAATCATCTGAAAGGCAGGG + Intronic
1087401615 11:97674086-97674108 CCCATATCAAATTTCAGGCAGGG - Intergenic
1089119209 11:116120983-116121005 CCCAAGTCAACTGTCATTATGGG - Intergenic
1089167617 11:116489120-116489142 CCCGAATGAGCTTTCAGGCTGGG - Intergenic
1090866666 11:130706844-130706866 CCCACCACAACTGCCAGGCTTGG - Intronic
1094567229 12:31610586-31610608 AAAAAATCAACTGTCAGGCCAGG + Intergenic
1095215059 12:39538406-39538428 CCCAAGTCATCTGTCTGCCTTGG + Intergenic
1098353075 12:69584031-69584053 CAAAAAACAACTGGCAGGCTGGG + Intergenic
1099582278 12:84465398-84465420 CCCAAACCAAATGTCTGTCTGGG - Intergenic
1100166963 12:91926799-91926821 GCAAAATCAACTATCAAGCTCGG - Intergenic
1102497041 12:113327007-113327029 CCAAAAGCAACAGTCAGGCTGGG + Intronic
1104973328 12:132541205-132541227 TGCAAATCCACTGTCAGCCTGGG + Intronic
1105887334 13:24653122-24653144 TCCAGGTCAGCTGTCAGGCTTGG - Intergenic
1107964576 13:45587568-45587590 CCCAAAACAACTGTGAGGTAGGG - Intronic
1111521710 13:89413341-89413363 CCCAAATCAAAGGTCAGACAGGG - Intergenic
1118216930 14:63817726-63817748 CCTAAAACAAATGTCAGGCCAGG + Intergenic
1123028192 14:105438467-105438489 CCAAAATGGACTGACAGGCTGGG - Intronic
1124655006 15:31500528-31500550 CCCGACTCAACTGCCAGGCCAGG + Intronic
1125852909 15:42921175-42921197 ACCAATTTAACTGTCACGCTAGG - Intergenic
1126004489 15:44243310-44243332 CACAAATCCTCTGTTAGGCTGGG + Intergenic
1131231264 15:90661115-90661137 CCCAAACCAACTCTCAGGCACGG - Intergenic
1132953427 16:2578030-2578052 CCCAAAGAAACGATCAGGCTGGG - Intronic
1132960924 16:2622138-2622160 CCCAAAGAAACGATCAGGCTGGG + Intergenic
1133421117 16:5647739-5647761 CCCTAATCAGCTGCCAGGCTTGG + Intergenic
1137250350 16:46736661-46736683 CCCAGATCATTTGTCAGACTTGG - Intronic
1137955190 16:52822394-52822416 CCCAAACGAACTCTCAGGCTTGG + Intergenic
1140700784 16:77579739-77579761 CCCAAATGTACTGAGAGGCTTGG + Intergenic
1142310112 16:89307366-89307388 CTCAGATTAACTGTCAGGTTTGG - Intronic
1143251271 17:5524980-5525002 CACAAATATACTGTCAGGTTTGG - Intronic
1143808654 17:9452590-9452612 GCCAAAGCTACTGCCAGGCTGGG - Intronic
1146243113 17:31248754-31248776 CTCAAATGATCTGTCAGCCTTGG + Intronic
1146373138 17:32277574-32277596 CCCCAGTCAACCCTCAGGCTGGG + Intronic
1156023538 18:32626330-32626352 CCCAAATCACAATTCAGGCTTGG + Intergenic
1156054033 18:32976248-32976270 CCCACATTGACTGTCAGGCTTGG - Intronic
1158512763 18:58106194-58106216 CCCAAATCAACTGTCAGGCTGGG + Intronic
1165198389 19:34125064-34125086 CCCAGATGAACAGTCAGGGTAGG - Intergenic
927453734 2:23231308-23231330 CCAAAATGAAGTCTCAGGCTGGG + Intergenic
927893378 2:26766134-26766156 CCCACACCAGCTGTCAGGCAGGG - Intronic
928259181 2:29751181-29751203 CCCAAAGCAACTTTCAGTCCAGG - Intronic
934271461 2:91540727-91540749 CCCAAATCACCTGCCAGCTTCGG + Intergenic
934900784 2:98158367-98158389 CCCACAACAGCTGGCAGGCTGGG + Intronic
935370181 2:102337191-102337213 CACAAATCAAATTTCAGGATGGG + Intronic
935400986 2:102660062-102660084 CCCAAATCAGATCTCAGGATAGG + Intronic
937799158 2:126061018-126061040 CCCACGACAACTGCCAGGCTTGG - Intergenic
940882889 2:158964573-158964595 CCCAACACATCTGTGAGGCTGGG + Intergenic
942261198 2:174165824-174165846 CATAACTCAAATGTCAGGCTGGG + Intronic
942805180 2:179922607-179922629 CGAAAATAAATTGTCAGGCTGGG + Intergenic
942942921 2:181640494-181640516 ACCCAATCAAGTGGCAGGCTAGG + Intronic
1169946135 20:10990896-10990918 CCCAAGTCAACCTTCAGGCCTGG - Intergenic
1172018783 20:31897842-31897864 CCCAAGTCCTCTGTCTGGCTAGG + Intronic
1172972757 20:38885472-38885494 CCCAAATCAGCTGTCAGCACAGG + Intronic
1175220946 20:57416172-57416194 CCTAACTCAAATGTCAGCCTTGG + Intergenic
1175265922 20:57703498-57703520 CCTTAATCCACTGCCAGGCTTGG - Intronic
1178574779 21:33776254-33776276 CCATAAGAAACTGTCAGGCTGGG + Intronic
1180159004 21:45990699-45990721 GGCCAATCAACTGTCAGACTTGG - Intronic
956781284 3:72605316-72605338 CCTAAGTCAACTCTCAGACTTGG - Intergenic
957988629 3:87603027-87603049 CCCCTACCCACTGTCAGGCTTGG + Intergenic
958258318 3:91350943-91350965 ACCAAATACATTGTCAGGCTGGG - Intergenic
959459238 3:106604379-106604401 GCCAAATCAGCTGTCAGGCTGGG + Intergenic
961077407 3:123994785-123994807 CCAAAATCATCTCTCAGCCTCGG + Intergenic
961257012 3:125564130-125564152 AACAAATCAACTGTTAGGTTGGG - Intronic
962158756 3:132977068-132977090 CAAAAAGCAACTGTCTGGCTGGG - Intergenic
965592128 3:170371265-170371287 CTCAAATCATCTGTCTGCCTTGG - Intronic
966847963 3:184145113-184145135 CCCAACTCCACAGTCAGGATGGG - Exonic
972566032 4:40269940-40269962 CCAAAATCAATTGTCAGACAAGG - Intergenic
972689225 4:41380440-41380462 ATCAAATCAAATCTCAGGCTGGG - Intronic
980306768 4:131072071-131072093 CCCAAGTCATCTGCCAGCCTTGG - Intergenic
984386139 4:179060141-179060163 CCCAAATCACTGGGCAGGCTTGG - Intergenic
985543335 5:497175-497197 CCCAGATCCACTTCCAGGCTCGG - Intronic
986948253 5:13049830-13049852 CCCAATTTAACTGTGATGCTAGG - Intergenic
994536096 5:101031131-101031153 TCCAAATCATATGTGAGGCTTGG + Intergenic
994893536 5:105670695-105670717 CCCAAATGAAGAGTCAGGGTTGG + Intergenic
995486025 5:112640920-112640942 CCCAAAGCAGCTCTGAGGCTGGG + Intergenic
999506188 5:152199229-152199251 CCCACATCCACTCTCAGACTTGG + Intergenic
1002147175 5:177193570-177193592 CTCAAATCAAGTTTCAGGCCAGG - Intronic
1002795996 6:471356-471378 ACCAAAGCATCTGTCAGGCTAGG - Intergenic
1003619697 6:7688642-7688664 CCCAGATCAAGAGACAGGCTGGG + Intergenic
1007621508 6:43218103-43218125 ATAAAATCCACTGTCAGGCTGGG - Intronic
1008996937 6:57669747-57669769 GCCAAATACATTGTCAGGCTGGG + Intergenic
1011559176 6:88597926-88597948 CCCAAATGCACTGTCAGGAGTGG + Intergenic
1012985672 6:105873977-105873999 CCTGAAACAACTGTCAGGTTGGG - Intergenic
1013269697 6:108534467-108534489 CCCAAACCAAGTGTCAAGGTGGG - Intergenic
1015544295 6:134346196-134346218 CTAAAATCAACTATCAGGCTGGG + Intergenic
1015685249 6:135851690-135851712 CCCAGACCAACTGACTGGCTGGG - Exonic
1017398642 6:154033128-154033150 CCAAAATAAATTGTCAGGGTGGG + Intronic
1017489089 6:154928567-154928589 CCAAAATCAAGTGTCAGGCCCGG - Intronic
1021218779 7:17949965-17949987 CCCAAGTGAACTGTCAGTGTGGG - Intergenic
1023045646 7:36208097-36208119 CCCAAATGAGCTGTCTGCCTGGG + Intronic
1029142941 7:98424551-98424573 CATAAATCATATGTCAGGCTAGG - Intergenic
1031562296 7:123253290-123253312 CAGAAAGCTACTGTCAGGCTTGG - Intergenic
1032253338 7:130276951-130276973 CCCATTTCAGCTGTTAGGCTGGG + Intronic
1033927201 7:146478025-146478047 CCCAAACCAACTCTCTGTCTGGG - Intronic
1034888368 7:154816871-154816893 ATTAAATCAACTGTCAGGCATGG + Intronic
1039105424 8:33984337-33984359 CCCAAACCAAGCTTCAGGCTAGG - Intergenic
1041151391 8:54938741-54938763 CCAAAATCAACTGTCTGAGTTGG + Intergenic
1044543463 8:93433318-93433340 CCCAAATCTACTGTCAGGAGTGG - Intergenic
1044790898 8:95845961-95845983 CCCAATTCCTCTGTCAGGCAGGG - Intergenic
1045435088 8:102154603-102154625 CCCAAATCTCCTGGCATGCTTGG - Intergenic
1047021455 8:120779207-120779229 CAAAAATAAACTGTAAGGCTGGG + Intronic
1047602123 8:126435988-126436010 CTCAAGTGAACTGTCAGCCTTGG + Intergenic
1053589711 9:39499644-39499666 CCCAAAACTACTTTCAGGTTTGG + Intergenic
1054576584 9:66865663-66865685 CCCAAAACTACTTTCAGGTTTGG - Intronic
1055943469 9:81671995-81672017 CCCAGGCCAACTGGCAGGCTAGG + Intronic
1056868065 9:90248577-90248599 ACCAAATCATCTTTCAGGATGGG - Intergenic
1057279102 9:93697679-93697701 CCCACCCCACCTGTCAGGCTTGG - Intergenic
1062121987 9:134838829-134838851 CCCAAACCACCTGTCCAGCTTGG - Intronic
1186639628 X:11441545-11441567 CCCAACTCAACTGTCCTCCTGGG + Intronic
1187023101 X:15405208-15405230 CCAAAATCAACTGTCACCTTTGG + Intronic
1187994132 X:24906952-24906974 CTCAAGTGAACTGTCCGGCTCGG - Intronic