ID: 1158513621

View in Genome Browser
Species Human (GRCh38)
Location 18:58113094-58113116
Sequence AACCGAAACTTATTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 1, 2: 23, 3: 57, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158513621_1158513623 15 Left 1158513621 18:58113094-58113116 CCTGTGAGAAATAAGTTTCGGTT 0: 1
1: 1
2: 23
3: 57
4: 162
Right 1158513623 18:58113132-58113154 AGTCTGTGATAGTTTGTTAGAGG 0: 1
1: 0
2: 9
3: 58
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158513621 Original CRISPR AACCGAAACTTATTTCTCAC AGG (reversed) Intronic
909239349 1:73192285-73192307 AACAGAAATTTGTTTCTCACAGG - Intergenic
909407503 1:75308056-75308078 AACCAACACTTCTTTCTCAATGG - Intronic
909921664 1:81388741-81388763 AATAGAAAGTTATTTCTCACAGG - Intronic
909970160 1:81974477-81974499 AGCAGAAACCTATTTCTCCCTGG - Intronic
909979502 1:82081858-82081880 AACAGAAATATATTTCTCCCTGG - Intergenic
910084232 1:83380172-83380194 AACAGAAATTTATTTCTCACAGG + Intergenic
910382773 1:86646392-86646414 AACAGAAACTTATTTCTCTATGG + Intergenic
911998272 1:104795803-104795825 AACACAAATTTATTTCTCATAGG - Intergenic
913967715 1:143391032-143391054 AACAGGCATTTATTTCTCACAGG - Intergenic
914062093 1:144216622-144216644 AACAGGCATTTATTTCTCACAGG - Intergenic
914117057 1:144749732-144749754 AACAGGCATTTATTTCTCACAGG + Intergenic
915032772 1:152897877-152897899 AAAGTAAACTTATTTCTCATTGG - Intergenic
917585096 1:176417850-176417872 AGCAGAAATTTATTTTTCACAGG + Intergenic
918223573 1:182457915-182457937 AACCCAAAGCTATTTTTCACTGG + Intronic
918790892 1:188826565-188826587 AACAGACATTTATTTTTCACAGG - Intergenic
918881246 1:190124343-190124365 GAGAGAAATTTATTTCTCACCGG - Intronic
919311607 1:195916990-195917012 AACCGAAACTTATATTTAAAAGG + Intergenic
921618597 1:217301200-217301222 AACCGAATCTCATTTTTTACAGG + Intergenic
922078548 1:222271959-222271981 AACAGAAATCTATTTCACACAGG + Intergenic
922325735 1:224526623-224526645 AACAAAAATTTATTTCTCAATGG - Intronic
923707872 1:236359879-236359901 AACAGAAATTTATTTCTAACAGG - Intronic
924118983 1:240777618-240777640 AACAGAAATTTATTTCTTATAGG + Intronic
924262815 1:242249400-242249422 AACAGAAACTTATTTGAGACTGG - Intronic
924316502 1:242803322-242803344 AGCAGAAATTTATTTCTCACAGG + Intergenic
924863527 1:247952612-247952634 AACAGAAACATATTTCTCAGAGG - Intronic
1063276813 10:4578330-4578352 AACAGAAATTTATTTCTCACAGG + Intergenic
1066298542 10:34076755-34076777 AACAGAAATTTAGTTCTCACAGG - Intergenic
1066725421 10:38387530-38387552 AACAGAAACTTATTTGAGACTGG + Intergenic
1068434628 10:56974203-56974225 AACTGAAACTTATATCTAAAAGG - Intergenic
1069520433 10:69115622-69115644 AATACAAACTTATTTCTCATTGG + Intergenic
1071589763 10:86861778-86861800 AGCGGAAACTTTTTCCTCACCGG + Intronic
1079549588 11:21677450-21677472 AAGAGAAGCTTATTTCTCATGGG + Intergenic
1080178256 11:29393115-29393137 AAAGGAAACTTCATTCTCACTGG + Intergenic
1081142010 11:39513146-39513168 AACAGAAATTTCTTTCTCACAGG + Intergenic
1082731299 11:56801167-56801189 AAGCTAAAATTATTTCTCCCTGG - Intergenic
1086669227 11:89527267-89527289 AACTGAAACTTATTTTTAAAAGG + Intergenic
1087463003 11:98468754-98468776 AACAGAAATTTATTTCTCACTGG - Intergenic
1088105642 11:106203959-106203981 AACAGAAATTTATTTCTCACAGG - Intergenic
1088356183 11:108946143-108946165 AAAACAAACTTATTTCTCACTGG - Intergenic
1088566389 11:111177380-111177402 AAAAGAAATTTATTTCTGACAGG + Intergenic
1089575188 11:119437148-119437170 AACAGAAATTTATTGCTCACAGG + Intergenic
1089663268 11:119999546-119999568 AACATAAATTTATTTCTCACAGG - Intergenic
1090048452 11:123357193-123357215 AATCAAAAGATATTTCTCACTGG - Intergenic
1092566250 12:9668774-9668796 ATCTGGAACTTATTTCTTACAGG + Intronic
1093999984 12:25684510-25684532 AAAAGAAACTTATTTCTTATTGG - Intergenic
1094237641 12:28186882-28186904 AATGCAAATTTATTTCTCACAGG - Intronic
1094396685 12:30014306-30014328 AACAGAAATTTATTTCTCACAGG - Intergenic
1095471621 12:42543127-42543149 AACAGAAATGTATTTCTCACAGG - Intronic
1095517883 12:43027206-43027228 AACAGAAATGTATTTCTCACAGG - Intergenic
1095552102 12:43455313-43455335 AACAGAAATTCATTTCCCACAGG + Intronic
1096686342 12:53290783-53290805 AAACCAAGCTTCTTTCTCACAGG - Intronic
1098164224 12:67677140-67677162 AACAAACATTTATTTCTCACAGG + Intergenic
1099745418 12:86696496-86696518 AACAGAATCATATTTCTCAAAGG - Intronic
1100402200 12:94242146-94242168 AACAGAAATTTCTTTCTCCCCGG + Intronic
1100901912 12:99250905-99250927 AACAGATATTTATTTCTCACAGG + Intronic
1100952923 12:99872494-99872516 AACCTGAAATCATTTCTCACTGG + Intronic
1101071048 12:101076397-101076419 AATAGAAATTTATTTCTTACTGG - Intronic
1103504060 12:121428705-121428727 AATCTAAAATTACTTCTCACTGG + Intronic
1104069103 12:125329273-125329295 AACAGATATTCATTTCTCACAGG - Intronic
1106352485 13:28946594-28946616 AACCGAAAGTTGTTTTTCAGAGG + Intronic
1106591628 13:31103566-31103588 AACAGAAATTTATTTCTCCTAGG + Intergenic
1108033771 13:46265416-46265438 AACAGAAATTTATTTCCCACAGG + Intronic
1109374731 13:61476964-61476986 AACAAAAACTTATTTCTTATAGG + Intergenic
1110378924 13:74827049-74827071 AGCAGAAATGTATTTCTCACAGG - Intergenic
1110677086 13:78261558-78261580 AACAGAAACTTATTTCTTACAGG - Intergenic
1111461685 13:88552750-88552772 AACTGAAACTTAATTTTCACTGG + Intergenic
1112770646 13:102791238-102791260 AACCCTGACTTATCTCTCACCGG + Exonic
1113044590 13:106141718-106141740 AATTGAAACTTATTTGTCACTGG - Intergenic
1113307937 13:109098301-109098323 AAACAAAACTTACTTCTCATTGG - Intronic
1113556994 13:111244841-111244863 GAATAAAACTTATTTCTCACTGG - Intronic
1116525316 14:45896894-45896916 AAAGGAAATTTATTTCTTACAGG - Intergenic
1117847356 14:59925273-59925295 AACAGAAATGTATTTCTCACAGG + Intronic
1118213977 14:63790825-63790847 AATGGAAACTTCATTCTCACTGG + Intergenic
1120616525 14:86712425-86712447 AAAGGAATCTTATTTCTCAAAGG - Intergenic
1125073578 15:35585745-35585767 AACAGAAAATCATGTCTCACAGG + Intergenic
1129063207 15:72878151-72878173 AACAGAAGTTTATCTCTCACAGG + Intergenic
1135882157 16:26268338-26268360 AACAGAAATGTATTTATCACAGG + Intergenic
1147401583 17:40183434-40183456 CACCGAAACTCCTTTCTCTCTGG + Intronic
1148407061 17:47424529-47424551 GACAGATACTTATTTCTCTCTGG + Intronic
1149954684 17:61035617-61035639 AGCTGAGCCTTATTTCTCACTGG - Intronic
1150695149 17:67398259-67398281 AAAACAAACTTATTTCTCATTGG - Intronic
1151178179 17:72306172-72306194 AATGGAGATTTATTTCTCACTGG - Intergenic
1151268541 17:72975614-72975636 AACAGACATTTATTTCTCACAGG - Intronic
1152410921 17:80122564-80122586 AACAGAAATGGATTTCTCACAGG + Intergenic
1153099353 18:1448336-1448358 AACAAAAAATTGTTTCTCACAGG - Intergenic
1156149920 18:34228710-34228732 AACAGGAATTTATTTCTCACAGG - Intergenic
1156708314 18:39911140-39911162 AACAGAAATGTATTTGTCACAGG - Intergenic
1158513621 18:58113094-58113116 AACCGAAACTTATTTCTCACAGG - Intronic
1158562951 18:58530862-58530884 AACAGAAACTTTTTATTCACCGG - Intronic
1158592801 18:58791700-58791722 AACAGAATTTTGTTTCTCACAGG - Intergenic
1158748836 18:60235023-60235045 AACAGAAATTTATTTCTCAAGGG + Intergenic
1159252532 18:65898327-65898349 GACAGAAACTTATTTCTCCTGGG - Intergenic
1160396193 18:78574009-78574031 AACAGGAACTTATGTTTCACAGG + Intergenic
1202701502 1_KI270712v1_random:168500-168522 AACAGGCATTTATTTCTCACAGG - Intergenic
929018935 2:37531070-37531092 AATAGAAATTTATTGCTCACAGG - Intergenic
930361039 2:50379900-50379922 AACATAATCTTATTTCTCAAAGG - Intronic
930867476 2:56136125-56136147 AACAGAAATTTATTTCTCACAGG + Intergenic
932932873 2:76062878-76062900 AACAGAAATTTACTTTTCACAGG - Intergenic
933701842 2:85260698-85260720 CACCGAAACATCTTTCACACGGG - Intronic
934172419 2:89551947-89551969 AACAGGCATTTATTTCTCACAGG - Intergenic
934282732 2:91626299-91626321 AACAGGCATTTATTTCTCACAGG - Intergenic
935431705 2:102983078-102983100 AACCTAAACTCACTTCTCAGTGG - Intergenic
935825813 2:106948152-106948174 AACAGAAATTTATTTCTTATAGG + Intergenic
936450962 2:112633814-112633836 AACAGAAATTCATTTCTCACAGG - Intergenic
937070794 2:119061510-119061532 AACAGAAATTTATTTCTTACTGG - Intergenic
937518528 2:122683438-122683460 AACAGAAATGTATTTCTCAGAGG - Intergenic
938559859 2:132462365-132462387 AACTGAAACCTACTTCTCAGGGG + Intronic
939518865 2:143204334-143204356 AACAGAAATTTATTTCTCATAGG + Intronic
939878259 2:147601984-147602006 AACAGAACTTTATTGCTCACAGG + Intergenic
940490651 2:154354987-154355009 AACTGAATCTAATTTCTGACTGG - Intronic
941242815 2:163061818-163061840 CACAGATGCTTATTTCTCACTGG + Intergenic
942735318 2:179104167-179104189 AAGAGAAACTTACTTCTCAATGG - Exonic
943557759 2:189426885-189426907 AACTGAAACTTATATCTAAAAGG + Intergenic
944985780 2:205174885-205174907 AACAGAAACATATTTTTCAAAGG + Intronic
946788239 2:223271353-223271375 AACAAAAACATATTTCTAACTGG - Intergenic
947043628 2:225952162-225952184 AACAGAAGTTTATTACTCACAGG - Intergenic
947205958 2:227661375-227661397 AAGAGACATTTATTTCTCACTGG - Intergenic
948106478 2:235418184-235418206 AACAGAAATTTATTTCTGATAGG - Intergenic
1169844170 20:9971725-9971747 AACAGAAATTTATTTCTCACAGG - Intergenic
1169882658 20:10364399-10364421 AAAAGAAACTTATTTCTCATTGG + Intergenic
1171198777 20:23224473-23224495 AACAGAAATTTATTTCTCACAGG - Intergenic
1171218960 20:23376336-23376358 AACCCCAACTTGTTTCTCAGGGG - Exonic
1175065219 20:56278510-56278532 AATCCAAGCTTATTTCTCCCTGG - Intergenic
1175596514 20:60239047-60239069 AACAGAAAGTCATTTCTCCCAGG - Intergenic
1175657354 20:60782656-60782678 AACTGAAGCTAATTGCTCACAGG - Intergenic
1177886109 21:26747561-26747583 AACAGAAATTTATTTCTCATTGG - Intergenic
1179772285 21:43631232-43631254 AGCAGTAACTAATTTCTCACTGG + Intronic
1180738693 22:18037861-18037883 AAAGGAGACTTATTTTTCACTGG + Intergenic
1181665607 22:24394226-24394248 AACAGAAATTTATTTCTCACAGG + Intronic
1182817661 22:33180141-33180163 ACCAGAAATGTATTTCTCACAGG - Intronic
1184566857 22:45297237-45297259 AACAGAAATTTCTCTCTCACAGG - Intergenic
949908205 3:8877204-8877226 AATAGAAATTTATTTCTCACAGG + Exonic
950478707 3:13231371-13231393 AACTGAAATTTATTTCTCACAGG + Intergenic
951759946 3:26136410-26136432 AACTGAAACTATTTTCCCACAGG - Intergenic
952234529 3:31464925-31464947 AAACGAAAAATACTTCTCACTGG + Intergenic
954898255 3:53996024-53996046 AACAGAAATTTATTTCTCACAGG - Intergenic
955478716 3:59367066-59367088 AACAGAAATTTACTTCTTACAGG - Intergenic
956774485 3:72553610-72553632 AATAGAAACTTACTTCTAACTGG + Intergenic
957458803 3:80490005-80490027 AAAGGAAACTTTCTTCTCACAGG + Intergenic
958060792 3:88477234-88477256 AACAGAAATTTATTTCTTACAGG + Intergenic
963071085 3:141305847-141305869 AACAGACATTTATTTCTCACAGG - Intergenic
963665662 3:148182757-148182779 AACAGAAATTTATTTCTCTCAGG + Intergenic
964074694 3:152679362-152679384 TAAACAAACTTATTTCTCACTGG + Intergenic
964178799 3:153858111-153858133 AATAGAAATGTATTTCTCACAGG - Intergenic
965313728 3:167164282-167164304 AACAGAAATTTATTTCTCACAGG - Intergenic
966058026 3:175719780-175719802 AACAGAAATTTATGTCTCACAGG + Intronic
966465498 3:180227319-180227341 AACCAAAACCAATTTATCACAGG + Intergenic
967508037 3:190276146-190276168 AACAGATATTTATTTCTTACAGG + Intergenic
969027323 4:4183909-4183931 AACAGGCATTTATTTCTCACAGG + Intergenic
969343086 4:6554557-6554579 AACAGAAATTGATTGCTCACTGG + Intronic
970763488 4:19518658-19518680 AGCAGAAATTTATTTCTTACTGG + Intergenic
970894378 4:21085343-21085365 AACCAACATTTATTTCTCACAGG - Intronic
972914004 4:43853496-43853518 AACAGAAATTTACTTCTCATAGG + Intergenic
973658920 4:53082181-53082203 AACAGAATCTTATTTCTCCTAGG + Intronic
973688780 4:53403489-53403511 TAAAGAAACTTATTTCTCATTGG - Intronic
974888440 4:67850345-67850367 GACAAAAATTTATTTCTCACAGG - Intronic
975079780 4:70262526-70262548 ATCCCATACTTATTTCTCAGAGG - Intergenic
976841235 4:89434277-89434299 AAGAGAAATTTATTTCTTACAGG - Intergenic
977379449 4:96253044-96253066 CACCTGAACTTCTTTCTCACTGG + Intergenic
977509387 4:97943002-97943024 AAATGAAATTTATTTCTCACAGG + Intronic
977983612 4:103356641-103356663 AAAAGAAATTTATTTCTCACAGG + Intergenic
982304936 4:153921157-153921179 AACCCACACATATTTCTTACAGG - Intergenic
984117806 4:175704103-175704125 AATATAAACTTAGTTCTCACAGG - Intronic
984370383 4:178856634-178856656 AAACCAAACTTATTTCACAGTGG + Intergenic
984691590 4:182732483-182732505 ATCTGAAAGTTATTTCTAACTGG - Intronic
984979365 4:185263565-185263587 AACTGAAATTTATTTTGCACTGG - Intronic
986031884 5:3902327-3902349 AAGAGAAATTTATTTCCCACAGG + Intergenic
987647384 5:20691402-20691424 AGCCGAAACCTGTTTCTCACAGG - Intergenic
987795106 5:22617323-22617345 AACAAAAATTTATTTCTCAGAGG - Intronic
991337124 5:65561564-65561586 AACTGAAATTTATTTCTCACAGG - Exonic
994689925 5:103005421-103005443 AACAGAAATTTGTTTCTCACAGG + Intronic
994899015 5:105745924-105745946 AAGCGAAAATGATTTCTAACTGG - Intergenic
994914763 5:105961008-105961030 AGCAGAAATTTATTTTTCACAGG + Intergenic
994942260 5:106339800-106339822 ACCAGAAATTTATTTCTCACAGG - Intergenic
997730726 5:136172133-136172155 AACAGAAATTTATTTCTCACAGG - Intronic
999964411 5:156793386-156793408 AAAACAAACTTATTTCTCATTGG + Intergenic
1003254774 6:4465423-4465445 AACGGGAGCTTATTTCTCAATGG - Intergenic
1004431158 6:15544852-15544874 AGCTGAAACTTGTTTCTGACAGG - Intronic
1004618761 6:17314965-17314987 AACAGAAGTTTATTTCTCACAGG - Intergenic
1007038065 6:38696425-38696447 AACAGACATTTATTTCTCACAGG + Intronic
1008110805 6:47492212-47492234 AACAGAAATTTATTGCTCACAGG + Intronic
1008253671 6:49271533-49271555 AATCAAAACTTTTTTCCCACAGG + Intergenic
1008425986 6:51357191-51357213 AATAGAAATTTATTTCTCACAGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009532054 6:64830255-64830277 AACAGAAATTTATTTCTTATAGG - Intronic
1010258476 6:73788153-73788175 AACTGAAACGTGTTTTTCACAGG - Intronic
1010766466 6:79781447-79781469 ACCAGAAACTTTTTTCTCCCAGG - Intergenic
1012431747 6:99171185-99171207 AAGTGAAAGTTATTTTTCACAGG + Intergenic
1012874252 6:104707585-104707607 AATAAAAATTTATTTCTCACAGG + Intergenic
1013452155 6:110294218-110294240 AACCGTCACATATTTTTCACTGG - Intronic
1013775689 6:113676212-113676234 AATGGAAACTTATTGCTCACAGG - Intergenic
1014837895 6:126181449-126181471 AACAGAAACTTCTCTATCACTGG - Intergenic
1015740052 6:136444160-136444182 CTCCGAAGCTCATTTCTCACAGG - Intronic
1016456471 6:144235919-144235941 AACAGAAATTTATTTCCCACAGG - Intergenic
1017549000 6:155483752-155483774 AACAGAAATGTATTTCTCACAGG - Intergenic
1018135151 6:160771802-160771824 CACAGACATTTATTTCTCACAGG + Intergenic
1018690147 6:166338075-166338097 AACAGAAATTTATTTCTTACGGG - Intronic
1021392046 7:20104618-20104640 AACAGAAATTTACTTCTCTCAGG - Intergenic
1021830519 7:24603157-24603179 GACAGAAATTTATTTCTCACAGG - Intronic
1022323698 7:29310657-29310679 AACAGAAATTTGTTTCTTACAGG + Intronic
1022748021 7:33192695-33192717 AACAGACATTTATTTCTCACAGG + Intronic
1023732954 7:43209590-43209612 AACTGAAACTTTTTTCACAGAGG - Intronic
1024234009 7:47384333-47384355 ACCCAAAACTCATTTCTCTCTGG + Intronic
1027301057 7:76836300-76836322 AACAGAAATTTATTTCTCACAGG + Intergenic
1028926329 7:96360120-96360142 AACTGAAACTTATTTTTTAAAGG - Intergenic
1029013509 7:97288322-97288344 AACAGATACTTATTTTTCACAGG - Intergenic
1032531069 7:132620849-132620871 AATAGACATTTATTTCTCACAGG + Intronic
1037143696 8:15548113-15548135 AACGGAAATTTATTTCTCACAGG - Intronic
1038163757 8:25064946-25064968 AACGAAAACTTGTTTCTAACAGG - Intergenic
1038475663 8:27865208-27865230 AATGGAAATTTATTTCTCACAGG + Intergenic
1039068605 8:33631093-33631115 CACAGCAATTTATTTCTCACTGG + Intergenic
1039940842 8:42089490-42089512 AGCAGAAATTTATTTCTCACAGG - Intergenic
1040633383 8:49242121-49242143 AATAGAAAGTTATTGCTCACTGG - Intergenic
1041445969 8:57951145-57951167 AACCTAAACTTAATTCTAATGGG + Intergenic
1041657046 8:60363188-60363210 GACAGAAATTGATTTCTCACAGG + Intergenic
1042596901 8:70459303-70459325 AAAGGAAATTTATTTCTCACAGG + Intergenic
1042938773 8:74086921-74086943 AACAGAAATTTATTTCTCACAGG - Intergenic
1048586943 8:135783185-135783207 AACAGAAATTTATTTCTCACAGG + Intergenic
1048651052 8:136477901-136477923 AACAAACATTTATTTCTCACAGG - Intergenic
1049135492 8:140894321-140894343 AACAGAAACTTATTTCTCACTGG - Intronic
1051652608 9:19344334-19344356 AACAGAAATTTATTTCTGCCGGG + Intronic
1055653415 9:78430411-78430433 AATAGAAATTTATTTCTCATAGG - Intergenic
1058485507 9:105439934-105439956 AACAGAAATTTATTTCTCACAGG + Intergenic
1186117998 X:6325382-6325404 AACAGAAACTTAATTTTCACAGG - Intergenic
1186768603 X:12795478-12795500 AATAGAAATTTGTTTCTCACAGG + Intronic
1187744940 X:22399056-22399078 AACAGAAAGTTAATTCTGACTGG + Intergenic
1188274769 X:28186087-28186109 AACAGACATTTATTTCTCACAGG - Intergenic
1188431936 X:30113462-30113484 CACAGAACTTTATTTCTCACAGG + Intergenic
1189526444 X:41827333-41827355 AACAGGAATTTATTTCTCATGGG + Intronic
1189713255 X:43837740-43837762 CACAGGAACTTATTCCTCACTGG - Intronic
1190479141 X:50858123-50858145 TACCTAAACTTATTTATCCCAGG - Intergenic
1190895921 X:54617843-54617865 AACAGAAACGTATTTCTTACAGG - Intergenic
1191790648 X:64968831-64968853 AACAAAAATTTATTTCTCCCAGG + Intronic
1192249380 X:69398740-69398762 AACAGTAATTTATTTCTCACAGG + Intergenic
1193480575 X:82022779-82022801 AACCAAAAATTATTTTTCTCTGG + Intergenic
1194751636 X:97691671-97691693 AACCCAACCTTATTTCTCACTGG - Intergenic
1197260155 X:124308782-124308804 AACAGAAGCCTCTTTCTCACAGG - Intronic
1197828057 X:130612078-130612100 AACAGAAATTTATTTCTCACAGG + Intergenic
1198920201 X:141717060-141717082 AACAGAAATTTATTTCTCACAGG + Intergenic
1199378244 X:147137596-147137618 AACAGAAATTTATTTCTTACTGG - Intergenic
1200320296 X:155181499-155181521 AAGAAAAATTTATTTCTCACAGG + Intergenic
1200367189 X:155679320-155679342 AACAGAAATGTATTGCTCACAGG + Intergenic
1201071531 Y:10151129-10151151 AACAGAAACTTATACCTCATAGG - Intergenic
1201220015 Y:11759867-11759889 AGCAGAAATTTATTTCTCACAGG + Intergenic