ID: 1158514277

View in Genome Browser
Species Human (GRCh38)
Location 18:58118554-58118576
Sequence ATGAACAAGAGGAGGAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158514277 Original CRISPR ATGAACAAGAGGAGGAATAC AGG (reversed) Intronic
902974616 1:20080007-20080029 AGGAACAAGAGGAAGAGGACGGG + Intronic
903159436 1:21474915-21474937 ATGAGCAAGAGGAAGAAAAAGGG + Exonic
903359952 1:22770818-22770840 ATGAACAGGTGGTAGAATACTGG + Intronic
904428213 1:30445419-30445441 ATGAAGAAAAGGAGGAAAAAAGG - Intergenic
904902094 1:33865478-33865500 ATGAACAAGAGGAAGAGGAGTGG - Intronic
905397895 1:37679005-37679027 ATGAACAAGAGTGGGAGTACAGG + Intergenic
905601395 1:39254979-39255001 ATGAGCATGAGGAGGAGTATTGG + Intronic
906192493 1:43906664-43906686 AGGAACAGGAGGAGGAAGAGTGG - Intronic
906260335 1:44382795-44382817 ATGAAAATGATGAGGAAGACTGG - Intergenic
908086071 1:60635600-60635622 ATGAACAAAATGAGAAGTACTGG + Intergenic
909821204 1:80064031-80064053 ATGACCAAGAACAGCAATACAGG + Intergenic
909823393 1:80094937-80094959 ATCAACAATAGGAGGAATTTTGG - Intergenic
910766512 1:90787961-90787983 ATGAACAAGCAGAGGGAGACAGG - Intergenic
911209394 1:95123327-95123349 ATGGAAAAGTGGAGGAATCCAGG + Intronic
911241105 1:95467887-95467909 ATCAACAAGAGGAGGAATTTTGG - Intergenic
911911119 1:103637106-103637128 ATCAGCAACAGGAGGAAAACTGG + Intergenic
911918534 1:103731248-103731270 ATCAGCAACAGGAGGAAAACTGG + Intronic
914827717 1:151147186-151147208 ACGAACCAGAGGAGGCCTACGGG - Intergenic
915521763 1:156449513-156449535 ATGAACAAGAGCAGCAACAGTGG + Intergenic
916191409 1:162182079-162182101 ATGTACTAGAGGAGGAAGCCAGG + Intronic
916636429 1:166674246-166674268 AAGAACAAGAAGAGGAAGACAGG - Intergenic
917260972 1:173168759-173168781 ATCAATAACAGGAGGAAAACTGG - Intergenic
917690423 1:177462719-177462741 ATAAGAAAGAGGAGGAAGACAGG + Intergenic
918418019 1:184332451-184332473 GTGAACCAAAGGAGGAATAAAGG - Intergenic
918704745 1:187646372-187646394 ATGACATATAGGAGGAATACGGG + Intergenic
918864702 1:189880419-189880441 ATGCACAAGAGTAGTAATGCTGG + Intergenic
919153427 1:193729517-193729539 CTGGAAAAGAGGAGTAATACAGG + Intergenic
921526726 1:216227544-216227566 AGGAACAAGAGTAGGAAAACAGG + Intronic
921835514 1:219774235-219774257 ATGCAGAAGAGGAGGAAAACTGG + Intronic
922823076 1:228497624-228497646 ATGTACAACAGGAGGAATGTAGG + Intergenic
923322806 1:232852661-232852683 AAGAAAAAGGAGAGGAATACAGG - Intergenic
923830545 1:237550759-237550781 ATGAATAAAAGGGGGAGTACTGG + Intronic
924562556 1:245169262-245169284 AAGAACAAGAGGAGAAATAAAGG - Intronic
924723881 1:246649414-246649436 ATGTACAAGAGAATGAATACCGG - Intronic
924838787 1:247685661-247685683 ATCAACAAGAGGAGGAACTTTGG - Intergenic
1063183954 10:3633800-3633822 AAGAAGGAGAGGAGGAATATTGG - Intergenic
1064844004 10:19630936-19630958 ATGTACAAGGGAAGGAAGACTGG + Intronic
1064887859 10:20132155-20132177 ATCAATAAGAGGAGGAAAATTGG - Intronic
1065615746 10:27521099-27521121 ATTAATAACAGAAGGAATACTGG - Intronic
1065639167 10:27764126-27764148 ATGTACAAGATGAGGATTATAGG + Intergenic
1065911895 10:30314481-30314503 AGGAAAAAGAGGAGGAACAAAGG + Intronic
1066556593 10:36621179-36621201 ATGAAGAAAAGAAGGAATAAAGG - Intergenic
1067658359 10:48214828-48214850 ATGAAGAAGTGAAGGAAGACTGG + Intronic
1068278887 10:54841248-54841270 ATCAACAAAAGGAGGAAAACTGG + Intronic
1068308235 10:55243252-55243274 ATGAACAAGAGTAGAACTGCAGG + Intronic
1068627838 10:59268553-59268575 TTGAACAAGAAAAGAAATACCGG - Exonic
1070674549 10:78403483-78403505 GTGATCAAGAGGAGGAAAGCAGG - Intergenic
1070860070 10:79648240-79648262 ATCAACAACAGGAGAAAAACTGG - Intergenic
1071951625 10:90709800-90709822 ATGAGCAAGAGGATGAATGTGGG - Intergenic
1072496597 10:95967282-95967304 CTAAACAAGGGGAAGAATACAGG + Intronic
1072752065 10:97988227-97988249 AGGATCTAGAGGAGGCATACTGG - Intronic
1072761969 10:98064015-98064037 AGGAAGAAGAGGAAGAAGACAGG + Intergenic
1073622939 10:105067575-105067597 ATGAAGAAAAGGAGGCAAACAGG - Intronic
1073705811 10:105982758-105982780 ATGCCCAAGACAAGGAATACTGG + Intergenic
1075953251 10:126500178-126500200 ATGAACATCTGGAGTAATACTGG - Intronic
1077691088 11:4343218-4343240 ATGAAAAAATGGAGAAATACTGG - Intergenic
1079835427 11:25327586-25327608 CTGAATAAGAGGAGAAAAACAGG + Intergenic
1080728615 11:34923180-34923202 ATGAACAAGATGGGGTATATGGG + Intronic
1080948079 11:36997301-36997323 TTTTACAAGAGGAGGAATGCTGG + Intergenic
1080969151 11:37248970-37248992 ATGAAGAGAAGGAGGAATTCTGG + Intergenic
1081693019 11:45090887-45090909 ATGAAGCAGAAGAGGAAGACAGG + Intergenic
1082710477 11:56548480-56548502 ATGAACAACATGAGGACTAGGGG - Intergenic
1085147644 11:74216325-74216347 ATCAATAAGAGGAGGAATTTTGG + Intronic
1085565482 11:77509513-77509535 ATGAACAGTAGGAGGCAAACTGG - Intergenic
1086533133 11:87810587-87810609 ATCAAAAAGTGGAGGAAAACTGG + Intergenic
1086566573 11:88233462-88233484 ATGAAAAAGAGGTAGAATACAGG - Intergenic
1087363410 11:97189195-97189217 CTGAACAAGAAAAGGAATTCTGG - Intergenic
1087585341 11:100112284-100112306 ATGAACATGTTGAGGAATAAGGG + Intronic
1088900460 11:114112472-114112494 ATGAGGAAGAGGAGAAAGACTGG + Intronic
1089690270 11:120182792-120182814 AGGAGGAAGAGGAGGAAAACTGG + Intronic
1091164376 11:133460051-133460073 ATTAACAACAGAAGGAAAACTGG + Intronic
1093053704 12:14533622-14533644 ATGAGGAAGAGGAAGAATACTGG + Intronic
1093772574 12:23034641-23034663 AAGAAGAAGAGGAGGAAGAAAGG - Intergenic
1094129860 12:27063251-27063273 AGGAAGAGGAGGAGGAACACAGG - Intronic
1094417838 12:30236077-30236099 ATGAACAAGTGGAGAGAGACAGG + Intergenic
1095917453 12:47494406-47494428 ATGAACAAGACAAGGTATTCCGG + Intergenic
1096485326 12:51976395-51976417 ATGAGGAACAGGAGGAACACCGG - Exonic
1096826083 12:54279359-54279381 ATGCTCAAGTCGAGGAATACAGG + Intronic
1096992732 12:55818234-55818256 ATGAACATGAGGAGGAAGCTGGG + Intronic
1097677697 12:62620777-62620799 ATCAGCAAGGGGAGGAATTCTGG - Intergenic
1098442075 12:70529562-70529584 ATATAGAAGAGGAGGAAAACAGG + Intronic
1098711134 12:73763808-73763830 ATCAACAATAGGAGGAATACTGG - Intergenic
1100175683 12:92028402-92028424 AAGACCAAGAGGAGAAATGCTGG - Intronic
1100415986 12:94375428-94375450 GTGAACAGGAGGAAAAATACAGG + Intronic
1101468469 12:104972336-104972358 CTGAACAAGAAGAGCAATGCAGG - Intergenic
1101680811 12:106963152-106963174 ATGAACAAGAGGTAGAATAGTGG + Intronic
1101784410 12:107870429-107870451 ATGCACAACAGGAGTACTACAGG + Intergenic
1102843843 12:116156338-116156360 ATTAACAAATGAAGGAATACTGG + Intronic
1104497406 12:129253842-129253864 ATTAACATGGGGAGAAATACAGG + Intronic
1106075043 13:26451791-26451813 ATCAATAAGAGGAGGAATTTTGG + Intergenic
1108801984 13:54109023-54109045 ATGAAAAAGATGAGGAAGATGGG + Intergenic
1108887813 13:55209743-55209765 AAGAAAAAGAGAAGAAATACAGG + Intergenic
1109309807 13:60679179-60679201 AAGTGCAAGAGTAGGAATACCGG - Intergenic
1109332394 13:60945635-60945657 ATGAACAAGATGAGACAGACTGG + Intergenic
1109555383 13:63967916-63967938 TTGAACAACAGGAGTAATACAGG + Intergenic
1109761259 13:66832898-66832920 AGGTAGTAGAGGAGGAATACAGG - Intronic
1110558894 13:76888734-76888756 CTGAACAAGGTGAGGAACACGGG - Intergenic
1112545628 13:100366549-100366571 AAGAAAAAAAAGAGGAATACTGG + Intronic
1112663204 13:101538345-101538367 ATGAATATGAGGAGGCATACTGG + Intronic
1112853621 13:103736461-103736483 ATGAACAAGGGAAGGAGTAACGG + Intergenic
1113233427 13:108240969-108240991 ATGCAAAGGAGTAGGAATACTGG + Intergenic
1113722418 13:112569564-112569586 ATGAACAAGAAGAGGAGGCCGGG + Intronic
1114350047 14:21840131-21840153 ATGGACTAGAGGAGGAACAGTGG + Intergenic
1114838246 14:26230498-26230520 AGGAAGAAGAGGAGGAAAAGGGG - Intergenic
1115833292 14:37366458-37366480 ATTAATAACAGGAGGAATTCTGG - Intronic
1116140616 14:40989197-40989219 ATCAACAACAAGAGGAATATTGG - Intergenic
1117594576 14:57313167-57313189 AAAAACCAGAGGAGAAATACAGG + Intergenic
1119142690 14:72282090-72282112 ATGAACAAGATGGGGAATAATGG + Intronic
1119219215 14:72893025-72893047 ATGAAAAGGAGGAGGAAGGCAGG + Intronic
1119781721 14:77280329-77280351 AAGAACAAGAGCAGGGAGACCGG - Intronic
1120121161 14:80681312-80681334 AAGAACCAGTGAAGGAATACTGG + Intronic
1120672141 14:87374702-87374724 AAAAACAAGAGTATGAATACAGG + Intergenic
1122081715 14:99271386-99271408 AAGAAGAAGAGGAGGAAGAGAGG - Intronic
1122110799 14:99500001-99500023 TTGAAAAAGAGAAGTAATACTGG + Intronic
1125425977 15:39549812-39549834 ATGTACAAGAGGAAGATTAATGG - Intergenic
1126310395 15:47309470-47309492 ATGCACAAGAGTAGTGATACTGG + Intronic
1126799886 15:52289123-52289145 ATGAAGAGGAGGAGGAAGAGAGG - Intronic
1130047488 15:80456948-80456970 AAGAACAAGATGGGGAATGCAGG + Intronic
1130833974 15:87631203-87631225 ATAAACCAGAGGAGGAAGGCTGG + Intergenic
1131781476 15:95864291-95864313 ATGCACAAGAGGGGGAAGAAAGG + Intergenic
1133592056 16:7254810-7254832 ATGAACAAGAAGAAAAAGACTGG + Intronic
1136087891 16:27898538-27898560 AGGAAGAGGAGGAGGAAGACAGG - Intronic
1136130733 16:28219287-28219309 AGGGACAAGAGGAGGAATGGAGG + Intergenic
1136176342 16:28519603-28519625 ATGAACAAGAGAATGAAGAGAGG + Intergenic
1136287174 16:29251311-29251333 ATGAACGAGCGGAGGAATGGGGG + Intergenic
1137255512 16:46771864-46771886 ATGAACAAGGGCAGGCATAGTGG + Intronic
1139164196 16:64546806-64546828 AAGAACCAGATGAGGAAAACTGG + Intergenic
1140237777 16:73174303-73174325 AACAACAAAAGGAGGAATAAGGG + Intergenic
1140256848 16:73345014-73345036 ATGAACAGGACAAGGGATACAGG - Intergenic
1140908456 16:79429945-79429967 AGGAAAAAGGGCAGGAATACAGG + Intergenic
1141891835 16:86931081-86931103 AAGAGGAAGAGGAGGAAGACAGG - Intergenic
1142092782 16:88223943-88223965 ATGAACGAGCGGAGGAATGGGGG + Intergenic
1143178335 17:4969075-4969097 ATGATCAAGAGGATGAGTAAGGG + Intronic
1146218373 17:30997258-30997280 ATGGGCATGAGGAGGAAGACGGG - Exonic
1147286812 17:39408902-39408924 ATGAGGAAGAGGAGGAAGAATGG + Exonic
1148969460 17:51466903-51466925 AAAAACAAGAGGAGGAAAAAAGG - Intergenic
1149536297 17:57436162-57436184 ATGAACCTGGGGATGAATACAGG + Intronic
1150059160 17:62049232-62049254 ATTAACAAGAGGAGAAAAAAAGG + Intronic
1150861945 17:68809642-68809664 ATGAAGAAGAGGAGGATAAAAGG + Intergenic
1150870003 17:68896694-68896716 AAGCACAAGAGGAGTAATGCTGG + Intronic
1152113995 17:78373629-78373651 ATGACCAAGGGGAAGAATAGAGG + Intergenic
1153534383 18:6085208-6085230 ATTTACAAGAGGAGAAATACTGG + Intronic
1154033453 18:10774565-10774587 CTGAACCAGAGAAAGAATACAGG + Intronic
1155712985 18:28905422-28905444 ATGAATAAGAGGAGAAATTGAGG - Intergenic
1156923052 18:42546126-42546148 AGAGGCAAGAGGAGGAATACTGG + Intergenic
1157042925 18:44061247-44061269 ATGAACAGCAGGAGGCAGACAGG - Intergenic
1158361157 18:56675158-56675180 TTGAAAAAGAAGAGCAATACTGG - Intronic
1158514277 18:58118554-58118576 ATGAACAAGAGGAGGAATACAGG - Intronic
1158650478 18:59280078-59280100 AAGGACAAGAGGAGGAATCCAGG - Intronic
1158971350 18:62669891-62669913 ATCAACTACAGGAGGAAAACTGG - Intergenic
1159346837 18:67216553-67216575 ACACACAAGAGGAGGAATACAGG - Intergenic
1159402431 18:67955540-67955562 AGGAAAAAGAGGAGGAAGAGAGG + Intergenic
1159436648 18:68426525-68426547 ATTAAAAAGAGTATGAATACAGG + Intergenic
1160339328 18:78074203-78074225 AAGCACAAAAGGAGGAAAACTGG + Intergenic
1160381969 18:78466182-78466204 ATGAATAAAAAGAGGAAGACTGG - Intergenic
1162053268 19:8048095-8048117 ATCAATAACAGGAGGAATTCTGG + Intronic
1162841147 19:13357376-13357398 ATGTACAGGAGGAGGAAGCCAGG + Intronic
1164558361 19:29270436-29270458 ATGAACAAGTGCAGGAACAGAGG + Intergenic
1164946703 19:32300632-32300654 ATTAACAACAAGAGGAATACTGG - Intergenic
1165846444 19:38820952-38820974 ATGAACAAGAGGAGGAACAGAGG + Intronic
1167123265 19:47531763-47531785 ATGAGGAAGAGGAGGCACACAGG + Intronic
927203092 2:20590561-20590583 ATGAGGAAGAGGTGGAGTACGGG - Intronic
927232544 2:20838308-20838330 ATGAAGAAGATGTGGAATAGAGG + Intergenic
928048612 2:27965804-27965826 AAGAAAAAAAGGAGGAATAAGGG - Intronic
928137974 2:28702902-28702924 ATGAACAACATGAGGGAAACAGG + Intergenic
929045940 2:37790091-37790113 ATTAATAACAGGAGGAATTCTGG - Intergenic
929086915 2:38177037-38177059 ATGAATCAGAGAAGAAATACAGG + Intergenic
929806917 2:45154183-45154205 GGGAAATAGAGGAGGAATACAGG - Intergenic
931528047 2:63179807-63179829 ATCAACAACAGAAGGAAAACTGG - Intronic
933309496 2:80642934-80642956 ATTAAGAAGAGTAGGAATAGAGG + Intronic
934049149 2:88195637-88195659 ATGAAAAAGAGGAATAAAACAGG + Intergenic
934087579 2:88523013-88523035 ATGCACAAGAGGATGACTAGTGG - Intergenic
935499638 2:103822389-103822411 ATGAACAGGAGGTGAAAGACAGG + Intergenic
936901861 2:117490151-117490173 ATGAACATGTAAAGGAATACCGG + Intergenic
936933963 2:117819986-117820008 ATGAACAAAAGGAAAAAAACAGG - Intronic
937074358 2:119090206-119090228 ATGAACAAGATGAGAACTAAGGG + Intergenic
938035241 2:128029274-128029296 ATGAGAAAGAGGAGGTATAATGG - Intergenic
940020254 2:149148746-149148768 CTCAACAAGAGGAGGCAAACTGG - Intronic
940148007 2:150567752-150567774 AGGAAGAAGAAGAGGAAGACTGG + Intergenic
940484670 2:154282321-154282343 ATGAACAAGAGAAAGAATAAAGG - Intronic
941435565 2:165466882-165466904 ATGTACAACATGAGGACTACAGG - Intergenic
941444035 2:165578926-165578948 ATGAAGAAGATGAGGCTTACAGG - Intronic
941613365 2:167689436-167689458 AAGAATAAAAGGAGGAATAGTGG + Intergenic
942439430 2:176017298-176017320 AAGAAGAAGAGTAGGAAGACAGG + Intergenic
943071374 2:183144356-183144378 CTCAACAAGAGGAGGAAGACTGG - Intronic
943512794 2:188846962-188846984 ATGTACAACATGAGGACTACAGG + Intergenic
945713702 2:213331712-213331734 ATCAACAAGAAGAGGAATTTTGG + Intronic
946363834 2:219236299-219236321 CTGAACAAGAGGAAGAAAAATGG - Intronic
947464522 2:230329918-230329940 ATGAACAAAATGTGGAATACAGG - Intronic
947555337 2:231087471-231087493 ATATACAAGAAGAGGAGTACTGG - Intronic
947566397 2:231196687-231196709 ATGAACAACATGAGGCATACGGG - Intergenic
1169948716 20:11018074-11018096 ATGAAGAAGAGGAGAAAAAAAGG + Intergenic
1170711079 20:18791632-18791654 CTGGCCAAGAGAAGGAATACAGG - Intergenic
1171154280 20:22858194-22858216 ATGAACAAGAGAAAGAACAAAGG - Intergenic
1172399638 20:34638699-34638721 ATGATCAAGAGGAGGAAAGCTGG + Intronic
1173153652 20:40589191-40589213 AAGAACAAGATGAAGAATAGTGG - Intergenic
1173774798 20:45695594-45695616 ATCAATAAGAGAAGGAAAACTGG + Intronic
1175056672 20:56205046-56205068 AAGAAAAATAGGAGGAACACTGG + Intergenic
1175516283 20:59572227-59572249 AGGAACAAGAGCAGGGATGCGGG + Intergenic
1178233617 21:30816182-30816204 ATCAATAACAGGAGGAAAACTGG + Intergenic
1181089223 22:20460725-20460747 ATAAAGAAGAAGAGGGATACAGG - Intronic
1181790813 22:25264652-25264674 GTGAACAAGAGGGGCAATATGGG + Intergenic
1181826629 22:25521693-25521715 GCGAACAAGAGGAGCAATATGGG + Intergenic
1182190971 22:28460389-28460411 ATGAAAAAGAGGAGTAGGACTGG - Intronic
1182779969 22:32859640-32859662 ATCACGAAGAAGAGGAATACAGG - Exonic
1182818957 22:33196768-33196790 AAGAAGAAGAGGAGGAAAAGAGG + Intronic
1183353541 22:37346462-37346484 AGAAATAAGAGGAGGAAGACAGG - Intergenic
1183890116 22:40920388-40920410 ATGAACATGAGGAGGCTTTCAGG + Intronic
1184071149 22:42148136-42148158 ATCAACAACAAGAGGAATTCTGG + Intergenic
950110173 3:10413685-10413707 TTGGACAAAAGGAGGAAGACAGG - Intronic
950993486 3:17467452-17467474 AAGAAGAACAGGAGGCATACAGG - Intronic
951387793 3:22063768-22063790 ATGAACCAGTGAAGGTATACAGG - Intronic
951819689 3:26794381-26794403 AGGAACCATAGGAGGGATACTGG + Intergenic
953027855 3:39154885-39154907 AAGAACAACAGGAGGAAAGCAGG + Intergenic
953405821 3:42659296-42659318 AGGAAGAAGAGGAGGAGGACGGG + Exonic
953511692 3:43547590-43547612 ATAAATAAGAGGAGGCATAATGG + Intronic
955711469 3:61783692-61783714 ATGAACAAGGGGTGGAAGCCAGG + Intronic
957424792 3:80023728-80023750 ATGAAGAAGAGGAGGCATGTTGG - Intergenic
958141452 3:89567814-89567836 ATTAATAACAGGAGGAATATTGG + Intergenic
958537848 3:95426756-95426778 ATGCACAAGTAGAGGAATATTGG - Intergenic
958768457 3:98397963-98397985 AAGAACGAGAGGAGTAATTCTGG + Intergenic
960029045 3:113039487-113039509 TTGAACAAGATGGGGAAAACAGG - Intergenic
960521153 3:118657342-118657364 ATGAATAAGAAGAGGAATTTTGG - Intergenic
960556680 3:119037567-119037589 ATGATCAGGATGAGGAATCCTGG + Intronic
960566991 3:119144482-119144504 ATCAATAAGAGAAGGAAAACTGG + Intronic
960632717 3:119749197-119749219 TTGAAAGAGAGGAGGAAAACTGG + Intronic
963014449 3:140808900-140808922 AGGAACAAGAAGAGAAATTCTGG - Intergenic
963771927 3:149395835-149395857 ATGAACAGGATGAAGAAAACTGG + Intergenic
965051421 3:163654803-163654825 AGGAACAAGAGTAGGAAAAATGG - Intergenic
965932621 3:174064411-174064433 GTGATCAAGAGCAGGAATTCTGG + Intronic
966087704 3:176089818-176089840 ATGAAAAAGAGGAGGAAGAGTGG + Intergenic
967830866 3:193918999-193919021 ATGAAGAAGAGGACAAAGACAGG + Intergenic
969705092 4:8787381-8787403 AAGAACAAGAGAACAAATACCGG + Intergenic
970129337 4:12849791-12849813 ATGAACAAGAGGAGCTATCTAGG - Intergenic
970415150 4:15849524-15849546 ATGAAGAGGAGGAGGAAGACGGG - Exonic
970491349 4:16577770-16577792 CTGAACAAAAGGAGCAAAACAGG + Intronic
972087322 4:35235342-35235364 AAGAAAAACATGAGGAATACAGG + Intergenic
972116742 4:35645230-35645252 ATGAGAAAGAGAAGGAATAATGG + Intergenic
973755494 4:54069479-54069501 CTGAACACGTGGAGGATTACAGG - Intronic
974220601 4:58965005-58965027 ATGTACAACAGGAGGACTATAGG + Intergenic
974264543 4:59567522-59567544 ATGTACAACATGAGGACTACAGG + Intergenic
974311823 4:60222046-60222068 ATGATAAAGAACAGGAATACTGG + Intergenic
974661120 4:64890035-64890057 AAAAACAAGAGGAGGAGTGCTGG - Intergenic
975448300 4:74493912-74493934 ATGAACAACATGAGGACTATAGG - Intergenic
975911666 4:79274314-79274336 AAGAACAAGAGGTGAAGTACAGG + Intronic
976018909 4:80595409-80595431 AAGAACAAAAGGAGGAAGAATGG - Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977463946 4:97359533-97359555 GGGATCAAGAGGAGGAATAGGGG - Intronic
977537117 4:98266988-98267010 ATGAACATCAGGAGGAATGAAGG + Intronic
977870840 4:102088845-102088867 AAGAAGACGGGGAGGAATACAGG + Intergenic
977881927 4:102214882-102214904 ATGAAAAGGGAGAGGAATACTGG - Intergenic
979567585 4:122172903-122172925 ATGAAGAAGAGGAAGAAAGCTGG + Intronic
979848173 4:125543435-125543457 ATGAAAATAAGGAGGAAAACTGG + Intergenic
982212965 4:153055835-153055857 ATAAACAATAGGAGGAGTAGGGG + Intergenic
982376835 4:154700829-154700851 ATGTACATCATGAGGAATACAGG + Intronic
982506623 4:156226725-156226747 ATGAACAATAGCAGGAGGACTGG - Intergenic
982602052 4:157464195-157464217 ATGAACAACAGAAGGAAAACTGG + Intergenic
987451914 5:18095590-18095612 ATGAATAAAAAGATGAATACAGG + Intergenic
988395065 5:30686711-30686733 AAGAACAAGAGGAAGAAAAAGGG - Intergenic
988996700 5:36721985-36722007 ATGGAGAAGACGAGGGATACAGG + Intergenic
993020974 5:82590334-82590356 AAGAAGAAAAGAAGGAATACAGG - Intergenic
993210325 5:84941349-84941371 ATGTACAACATGAGGAATATAGG - Intergenic
993894713 5:93520496-93520518 CTCAACAAGAGGAAGTATACAGG + Intergenic
995688659 5:114799230-114799252 AGGAAGAAAAGGAGGAATAGAGG + Intergenic
996351346 5:122545627-122545649 ATGAACAGGAGGAGCAATTAGGG + Intergenic
997184397 5:131866916-131866938 ATGAAGAAGGGGAGGAAGAGAGG - Intronic
997662416 5:135599723-135599745 ATGAACAAGAGAAGGAAGGAAGG - Intergenic
998125506 5:139617758-139617780 ATGAAAAAACTGAGGAATACAGG - Intronic
998419473 5:141970310-141970332 ATGAACAAGAGAGGAAAAACTGG + Intronic
1000745081 5:165022696-165022718 ATGAACAAAAGTAGGAAAACTGG + Intergenic
1001780457 5:174364483-174364505 ATGAGCAGGAGGAGGAGTAGGGG - Intergenic
1003650447 6:7954730-7954752 AGGAAGAACAGGAAGAATACTGG - Intronic
1004663823 6:17733191-17733213 ATAAAAAAGAAGAGGAATATTGG - Intergenic
1005534442 6:26741676-26741698 ATGAAGATGAGGAGAAATAATGG + Intergenic
1005536406 6:26760337-26760359 ATGAAGATGAGGAGAAATAATGG - Intergenic
1006259847 6:32858570-32858592 AGGAACAGGAAGAGAAATACAGG + Intronic
1008020420 6:46571033-46571055 ATCAATAACAGGAGGAAAACTGG - Intronic
1008348907 6:50464800-50464822 AAGAACAAGAGAAGAAATCCAGG - Intergenic
1008444326 6:51570784-51570806 ATTAGGAAGAGGTGGAATACTGG + Intergenic
1008483713 6:52012963-52012985 AAAAAAAAGAGGAGGAATTCTGG - Intronic
1008710737 6:54223960-54223982 ATGAATAAGAAGAGTAATAAAGG + Intronic
1008895932 6:56555202-56555224 GTGAAGAGGAGGATGAATACAGG - Intronic
1010145111 6:72659182-72659204 ATAAACAAGAGGAGAGATATGGG - Intronic
1010837217 6:80603851-80603873 ATGAACAACAAGAGGAATTTTGG - Intergenic
1011172859 6:84525619-84525641 ATGAACAAATGAAGGAATCCTGG - Intergenic
1011408697 6:87043279-87043301 AAGAACAAAAGGAGCAATCCAGG - Intergenic
1011633316 6:89348237-89348259 AAGAACAAGAGCAGGCATCCAGG - Intronic
1012368576 6:98473656-98473678 ATCAATAACAGGAGGAAAACTGG + Intergenic
1012492050 6:99793027-99793049 AAGAACAAGAGGAAGAACAGTGG + Intergenic
1012934432 6:105351329-105351351 ATGAATATGAGGAAGAATAAAGG - Intronic
1014173641 6:118307474-118307496 AAGAAAAAGAGGAGAAATAAGGG + Intronic
1015943845 6:138479362-138479384 AAGGACAAGAGGAGTAATGCTGG - Intronic
1016056953 6:139588059-139588081 AGGAACAAGAGTAAGATTACTGG + Intergenic
1016643230 6:146375182-146375204 ATGAATAACAAGAGGAATTCTGG - Intronic
1016793593 6:148093260-148093282 ATCAATAACAGGAGGAAAACTGG + Intergenic
1017603868 6:156112331-156112353 AAGAACAAGATGATGAAAACTGG - Intergenic
1017764554 6:157595945-157595967 AGGATCTAGAGGAGGAAGACTGG + Intronic
1017894513 6:158667689-158667711 AGGAACAAGATGAGGAAAATTGG + Intronic
1019026342 6:168967178-168967200 ATGAACAAGAGGAAAAAAAAAGG - Intergenic
1019576857 7:1741746-1741768 GTGAACATGAGGAGGAAATCTGG + Intronic
1020753685 7:12173610-12173632 AGGAGCAAGGGGAGGAAAACAGG + Intergenic
1021124005 7:16829503-16829525 ATCAACAACAGGAGGAATTTTGG + Intronic
1021913408 7:25408553-25408575 ATGAAGAGGAGGGGGAATAGTGG - Intergenic
1022560150 7:31339074-31339096 AAGAAGAAGAGGAGGAAGACAGG - Exonic
1022570739 7:31451144-31451166 ATAAACCAGAGCAGGAATAAGGG - Intergenic
1025851565 7:65248865-65248887 ATGAACAAGAGCAGGAAAAGTGG + Intergenic
1028158098 7:87455201-87455223 GTAAACAAGAGGTGGAATGCAGG - Intronic
1033093029 7:138404345-138404367 ATGAACAAGAGGAAGAAGGTGGG - Intergenic
1035135873 7:156702928-156702950 CTGAAAAAGAGAAGGAAAACAGG + Intronic
1035636808 8:1153556-1153578 ATGAAAAAGAGGATAAAAACAGG - Intergenic
1035656492 8:1310858-1310880 ATTAATAACAGGAGGAAAACTGG + Intergenic
1036458119 8:8927319-8927341 AAAAACAAAAGGAGAAATACAGG + Intergenic
1036526176 8:9536940-9536962 GTGAGGAAGAGGAGGAATTCAGG - Intergenic
1038074758 8:24059011-24059033 ATCAATAACAGGAGGAAAACAGG + Intergenic
1039986318 8:42451257-42451279 AGGAAGAAGAGGAGGAGGACAGG + Intronic
1040010008 8:42653474-42653496 ATGAATGAGTGGATGAATACAGG + Intergenic
1040421844 8:47247742-47247764 ATGTACAACATGAGGACTACAGG - Intergenic
1041156853 8:54996269-54996291 AGGAAGAAGAGGAGGGAAACTGG + Intergenic
1041177054 8:55207741-55207763 AGGAAGAAAAAGAGGAATACAGG + Intronic
1041557970 8:59180680-59180702 AGGAACAAGAGGAGTAAGAGGGG + Intergenic
1042042904 8:64613482-64613504 ATGAATAAGATGACGCATACTGG - Intronic
1042107950 8:65348777-65348799 ATGAACAAGAGGTTGAATATAGG + Intergenic
1042884895 8:73537757-73537779 ATGAAAAAGAGTATGAATATTGG + Intronic
1042945943 8:74154520-74154542 AAGAACAGGAAGAGTAATACTGG + Intergenic
1043511746 8:80956984-80957006 ATGAACAAGAGGAGAAGATCAGG - Intergenic
1044804109 8:95987378-95987400 ATGGGCCAGAGGAGGAATATGGG + Intergenic
1045810868 8:106218300-106218322 ATGAACATGAGGAGGCCTTCAGG - Intergenic
1046104770 8:109652323-109652345 AAGAAGAAGAGGAGGAAGAGAGG - Intronic
1046686905 8:117237925-117237947 ATGAACAAGATGTGGAATCCTGG - Intergenic
1047318630 8:123757405-123757427 ATGAACAGAAGGACAAATACTGG + Intergenic
1048400296 8:134060456-134060478 ATCAACAACAGGAAGAAAACTGG + Intergenic
1048441622 8:134463359-134463381 AGGGACATGAGGAGGAATACAGG + Intergenic
1048802237 8:138205030-138205052 ATCACCAAGAAGAGGAATCCAGG - Intronic
1050232989 9:3548338-3548360 ATTATCAAGAAAAGGAATACAGG - Intergenic
1051065033 9:13092874-13092896 ATGAACAAGGGGAGAGTTACGGG + Intergenic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1052206394 9:25846432-25846454 AGGGACCACAGGAGGAATACTGG - Intergenic
1052613577 9:30808992-30809014 ATGAAGAACAGGTGGAATAAAGG + Intergenic
1054898283 9:70338662-70338684 ATGAACAATGGTAGGAACACTGG - Intronic
1055429478 9:76229018-76229040 ATGAATAAGAGAAGGAAAAGAGG + Intronic
1057371360 9:94477350-94477372 ACCAACAAGAAGAGGAATTCTGG + Intergenic
1058512420 9:105734250-105734272 ATCAACAACAGGAGGAATTTTGG - Intronic
1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG + Exonic
1061527744 9:131181274-131181296 GGGAACAAGAGGAAGAATGCTGG + Intronic
1185499178 X:584472-584494 AGGAAGAAGAGGAGGAAAAAGGG + Intergenic
1185980646 X:4774389-4774411 TTGACCAAGAGTAGGCATACAGG + Intergenic
1186608103 X:11111925-11111947 ATGACAAAGAGGAGGAACAAGGG + Intronic
1188565261 X:31520027-31520049 ATGAGGAAAAGGAGGAAGACAGG + Intronic
1188996365 X:36890878-36890900 ATGAATAAAAAGAGGAATTCGGG + Intergenic
1189050925 X:37644696-37644718 ATGAAGAAGAGGAGGGCTACAGG - Intronic
1189420809 X:40856019-40856041 ATGGGCAAGAGAAGGAAAACAGG + Intergenic
1190462749 X:50694839-50694861 ATGAACAAAAGGAGAAAGACGGG + Intronic
1190643125 X:52499881-52499903 ATGAACACATGGAGGGATACGGG - Intronic
1190644547 X:52512986-52513008 ATGAACACATGGAGGGATACGGG + Intronic
1190976987 X:55415160-55415182 ATGGACAGGAGGAAGAATATTGG - Intergenic
1191663156 X:63671053-63671075 ATGAAAAAGAGGAGTCATAGGGG - Intronic
1194311185 X:92309386-92309408 ATTCACAAAAGGACGAATACTGG + Intronic
1195000369 X:100637449-100637471 ATAAAAAAGGAGAGGAATACTGG - Intronic
1195214195 X:102681621-102681643 ATCAACAACAGGAGGAATCTTGG - Intergenic
1195823769 X:108974625-108974647 ATCAACAACAGGAGGAATTTTGG + Intergenic
1197022006 X:121702434-121702456 ATTAATAAGAGGAGGAATTTTGG - Intergenic
1198189822 X:134291550-134291572 ATCAACAACAGGAGGAAAACTGG - Intergenic
1198190288 X:134297649-134297671 ATCAACAAGAGGAGGAAAACTGG + Intergenic
1198769218 X:140110755-140110777 ATTAATAAGAGAAGGAAGACAGG + Intergenic
1199217653 X:145279231-145279253 ATCAATAAGAAGAGGAATATTGG - Intergenic
1200467578 Y:3539073-3539095 ATCAATAACAGGAGGAATATTGG + Intergenic
1200619458 Y:5423673-5423695 ATTCACAAAAGGACGAATACTGG + Intronic