ID: 1158516611

View in Genome Browser
Species Human (GRCh38)
Location 18:58135880-58135902
Sequence ACGTCTTCTTCAAGAAACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158516611_1158516619 28 Left 1158516611 18:58135880-58135902 CCCGTGTTTCTTGAAGAAGACGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1158516619 18:58135931-58135953 TACCCCTTGTGTGGTTGGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 67
1158516611_1158516615 2 Left 1158516611 18:58135880-58135902 CCCGTGTTTCTTGAAGAAGACGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1158516615 18:58135905-58135927 GGTTTTGTTTTGCTCATTGATGG 0: 1
1: 1
2: 2
3: 24
4: 327
1158516611_1158516616 19 Left 1158516611 18:58135880-58135902 CCCGTGTTTCTTGAAGAAGACGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1158516616 18:58135922-58135944 TGATGGCCATACCCCTTGTGTGG 0: 1
1: 0
2: 1
3: 3
4: 66
1158516611_1158516617 23 Left 1158516611 18:58135880-58135902 CCCGTGTTTCTTGAAGAAGACGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158516611 Original CRISPR ACGTCTTCTTCAAGAAACAC GGG (reversed) Intronic
909980483 1:82094632-82094654 ACATCTCATTCATGAAACACAGG - Intergenic
917255824 1:173115235-173115257 AGGTCTTCTTTCAGGAACACAGG + Intergenic
921940441 1:220833324-220833346 CCCTCTTCTTCAAGAACCAAGGG + Intergenic
1066235020 10:33477193-33477215 TAATCTTATTCAAGAAACACAGG - Intergenic
1068745246 10:60522921-60522943 ACCTCTTCTACAAGAAAGATGGG + Intronic
1071054615 10:81494686-81494708 AAGTCTATTTCAAGAAAGACTGG - Intergenic
1074355567 10:112780501-112780523 ACGCCTTCTGCAAGAAGCAAAGG - Intronic
1074484394 10:113859689-113859711 ATGTCTTGAACAAGAAACACTGG - Intronic
1075573703 10:123563269-123563291 TCTTGTTCTCCAAGAAACACTGG + Intergenic
1078709596 11:13778250-13778272 ATGTGTTATTCAAGATACACTGG - Intergenic
1079088146 11:17461799-17461821 ACATCTTCTTCAAGACACCGAGG - Exonic
1082932370 11:58622014-58622036 ACATCTTGTTCAAGAAACAAAGG - Intronic
1083585060 11:63851002-63851024 ACGTGGTCTTTAAGAAAAACTGG - Intronic
1088043563 11:105419309-105419331 ACGCCGTCTTAAAGATACACAGG - Intergenic
1089655266 11:119942482-119942504 GTGTCTTCTCCAAGAAACAGTGG - Intergenic
1090632167 11:128659114-128659136 ATCTCTTCTCCAAGAAACACTGG + Intergenic
1091128348 11:133122360-133122382 AAGTCTTCTCCAAGAAAAATGGG + Intronic
1094691201 12:32771377-32771399 ACGTTTGCTTTAAGAAACAAGGG + Intergenic
1095221177 12:39618202-39618224 ATGTCTTCTATAAGAAACCCTGG + Intronic
1095284559 12:40392919-40392941 GCATTTTCTTAAAGAAACACAGG - Intergenic
1100628998 12:96367950-96367972 ACGTATACATCAAAAAACACTGG + Intronic
1109689321 13:65865220-65865242 ATGGCTTCTTCCACAAACACTGG - Intergenic
1111639515 13:90949073-90949095 AAGTCTGCTTCCAGGAACACTGG - Intergenic
1112965872 13:105193062-105193084 ATTTCTTTTTCCAGAAACACTGG - Intergenic
1113866104 13:113525989-113526011 ACGGCTTCTTCTAGAATAACCGG - Intronic
1116944018 14:50818997-50819019 ACTTCTTTTTCAAGAAAAAAAGG + Intronic
1121182246 14:91938108-91938130 ACTTCTACTTCAAGTAACAGTGG + Intronic
1124046949 15:26159473-26159495 CCGTCTGCTCCATGAAACACAGG + Intergenic
1126536579 15:49773006-49773028 ATCTCTTTCTCAAGAAACACTGG + Intergenic
1130184440 15:81666450-81666472 ACTTCTTCTGCAACAAACTCTGG - Intergenic
1131371462 15:91885422-91885444 CCGGCTTCTTCCTGAAACACAGG - Intronic
1131751017 15:95508432-95508454 ATGTGTTCTTCAAAATACACTGG + Intergenic
1143535981 17:7539944-7539966 GTGTCTTCTTCCAGAAACATAGG + Intergenic
1144202690 17:12955628-12955650 ACATCTGCTTCAACTAACACTGG - Intronic
1144302940 17:13940000-13940022 AGGTCTTCCTTAAGAAACACTGG + Intergenic
1147050959 17:37794531-37794553 ACGGCTGCTGCAAGAAACAGTGG + Intergenic
1149259825 17:54866994-54867016 ATGTGTTCTTCTAGAAACAAAGG - Intergenic
1155515329 18:26618901-26618923 ACTTATTCTTACAGAAACACTGG - Intronic
1158516611 18:58135880-58135902 ACGTCTTCTTCAAGAAACACGGG - Intronic
1159346198 18:67208753-67208775 ATGTCTCCTTCATGAAACAAAGG + Intergenic
1160138992 18:76302453-76302475 ACTTGTTCTTCAAGCAACCCTGG - Intergenic
1161096639 19:2396029-2396051 AGGTCATCTTCAAAAACCACTGG - Intronic
1163904830 19:20143341-20143363 GGGTCCTTTTCAAGAAACACTGG + Intergenic
928925571 2:36575483-36575505 AGGTGTTCTTCAAGATACAGTGG - Intronic
933371291 2:81418817-81418839 ACATCTTCTTCAAAACCCACAGG + Intergenic
934738188 2:96700683-96700705 AGGTCATCTACAAGAAACAGAGG + Intergenic
935230622 2:101092756-101092778 ACCATTTCTTCAAGAAACTCTGG + Intronic
936961625 2:118081117-118081139 ATGTCTTCTTCTAAAAACAGAGG + Intergenic
937468530 2:122155719-122155741 GCGGCTTCTTCAAGAAGCAAAGG - Intergenic
946721963 2:222618451-222618473 ATGTCTTCTTCTAGAATCAAGGG - Intronic
948608080 2:239148682-239148704 ACGACTTCTCCAAGAGCCACTGG + Intronic
1172471384 20:35199448-35199470 AAGTCTTATTTAAGAAATACAGG + Intergenic
1173273577 20:41558448-41558470 ACGTCTTCTTCCTGTGACACTGG - Intronic
1173847667 20:46198330-46198352 ACATATTCTTCCAGAAACTCAGG + Intronic
1175406959 20:58741204-58741226 AGGTCTTCATCATGAAGCACTGG - Intergenic
1178671727 21:34596640-34596662 AAGTCTTCTTTTAGAAGCACTGG + Intronic
1184215431 22:43063813-43063835 ACGTCGCCATCCAGAAACACGGG - Exonic
949718095 3:6956772-6956794 ATGTCTTGTTCAAGTAGCACAGG + Intronic
953566708 3:44038151-44038173 AAGTCTTCTATCAGAAACACTGG - Intergenic
957163502 3:76640740-76640762 ACCACTTCTCCAAGAAACCCTGG - Intronic
960005092 3:112773615-112773637 AGGTCTTCATCAAGTAATACTGG + Intronic
966692545 3:182756597-182756619 ACTTCTACTGCAAGACACACAGG - Intergenic
967830382 3:193913736-193913758 ACGTCTGTTTCTAGAAACACAGG + Intergenic
969108624 4:4827534-4827556 ACGGCTTTCTCAGGAAACACAGG - Intergenic
972610886 4:40654366-40654388 ACAGCTTCTTCATGAAACAGAGG - Intergenic
972907395 4:43768064-43768086 ACGCCATCTTCCAGACACACTGG + Intergenic
974283832 4:59837849-59837871 ATGCCTTGTTAAAGAAACACAGG - Intergenic
974462367 4:62204742-62204764 AAGTCTTTTTCAAGAGACAGAGG + Intergenic
974507734 4:62798444-62798466 AAGACATCTTCAAGCAACACAGG + Intergenic
974920138 4:68228854-68228876 AAGTCTTCTTGAAGTATCACTGG + Exonic
978132668 4:105218146-105218168 TCTTCATCTTCAAGAATCACTGG - Intronic
983187295 4:164714836-164714858 ACTCCTTCCTCAACAAACACAGG + Intergenic
985325130 4:188758922-188758944 AAGTCTTCTACAAGGAATACAGG + Intergenic
994753444 5:103766318-103766340 ACCTCTTCTTCAAAAAATATCGG + Intergenic
996692927 5:126360297-126360319 AGGTGATCTTCAAGAAACTCTGG - Exonic
1000851851 5:166350027-166350049 TCTTCTTCTTCAAGAAAAAAGGG - Intergenic
1001456100 5:171860897-171860919 ACGTTTTCTACAAGAAAAACGGG + Intergenic
1001692136 5:173641202-173641224 ACGGCATCTCCCAGAAACACGGG - Intergenic
1006060149 6:31413177-31413199 ATGTCATCTGCAAGAAACTCAGG - Intronic
1007165417 6:39825455-39825477 ATGTTTCCTTCAAGAAACAAAGG - Intronic
1012557800 6:100536875-100536897 AGGTAGTATTCAAGAAACACTGG + Intronic
1018752694 6:166821454-166821476 ATGTCTTCTTCCAGAAATCCCGG + Intronic
1019834198 7:3365311-3365333 ACCTCTTTTCCAAGAAACTCTGG + Intronic
1020017719 7:4841229-4841251 TCGTCTTCTTCAAGGACCCCTGG + Intronic
1020517957 7:9148842-9148864 ATGTCCTCTTTAAGAAAGACAGG - Intergenic
1024405412 7:48973807-48973829 AAGACTTCTTGAAGAAACATAGG + Intergenic
1028839687 7:95415169-95415191 ACTTCTTCCTCCAGAAAAACTGG + Intronic
1030321364 7:108171776-108171798 ACAGCTTCTTAAACAAACACGGG + Intronic
1031274147 7:119696637-119696659 ACCTCTTATTTAAGAAAAACGGG - Intergenic
1031996068 7:128232030-128232052 ACCTCTTCTAAAAGAAAAACCGG + Intergenic
1040289788 8:46118385-46118407 CGGCCTTCTGCAAGAAACACAGG + Intergenic
1040292457 8:46132412-46132434 AGGTCTTCTGCGAGATACACAGG + Intergenic
1040293496 8:46137381-46137403 GGGTCTTCTGCAAGAGACACAGG + Intergenic
1040300814 8:46187107-46187129 AGGTCTTCCGCAAGAGACACAGG + Intergenic
1040303790 8:46201746-46201768 AGGCCTTCCTCAAGAGACACAGG - Intergenic
1040305671 8:46210556-46210578 GGGTCTTCTGCGAGAAACACAGG - Intergenic
1040306844 8:46216420-46216442 AGGCCTTCTGCAAGAGACACAGG - Intergenic
1040309287 8:46228399-46228421 ATGTCTTCTGCGAGAGACACAGG - Intergenic
1040315831 8:46260447-46260469 AAGTCTTCCTCGAGAAGCACAGG - Intergenic
1040316240 8:46262393-46262415 GGGTCTTCTGCGAGAAACACAGG - Intergenic
1040325936 8:46341540-46341562 ATGCCTTCTGCAAGAGACACAGG - Intergenic
1040331687 8:46388897-46388919 GCGCCTTCTGCGAGAAACACAGG - Intergenic
1040333199 8:46402823-46402845 GGGCCTTCTACAAGAAACACAGG - Intergenic
1048535365 8:135289307-135289329 AGATCTTCTTGGAGAAACACTGG + Intergenic
1049908726 9:244864-244886 CAGTCTTCTTCAAAACACACTGG - Intronic
1052695513 9:31872338-31872360 ACGTCTTTATCAAGTAGCACTGG + Intergenic
1055590578 9:77808998-77809020 ACTTCCTCTTCAAGAAGGACTGG + Intronic
1057164256 9:92913800-92913822 AAGGCCTGTTCAAGAAACACAGG + Intergenic
1187237170 X:17478214-17478236 AAGTCTTCTTCATGACACAAGGG - Intronic
1193052941 X:77120600-77120622 ACTTCTTCTTCAAAAAAAATTGG + Intergenic
1194241471 X:91455514-91455536 ACGTCTTCTTAAAAACACAAAGG + Intergenic
1194327923 X:92543388-92543410 ACGTCTTCTTTTAGAAAAATTGG - Intronic
1195372481 X:104191684-104191706 ACCTATTCTTCAAGGAAAACAGG + Exonic
1196238429 X:113310220-113310242 ACGTTTGAGTCAAGAAACACTGG + Intergenic
1196869040 X:120095891-120095913 ACTTCCCATTCAAGAAACACAGG - Intergenic
1197537715 X:127709894-127709916 ACAACCTCTTCAAGAAAGACAGG + Intergenic
1201619457 Y:15939880-15939902 ACACCTCCTTCAGGAAACACTGG - Intergenic