ID: 1158516612

View in Genome Browser
Species Human (GRCh38)
Location 18:58135881-58135903
Sequence AACGTCTTCTTCAAGAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158516612_1158516615 1 Left 1158516612 18:58135881-58135903 CCGTGTTTCTTGAAGAAGACGTT 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1158516615 18:58135905-58135927 GGTTTTGTTTTGCTCATTGATGG 0: 1
1: 1
2: 2
3: 24
4: 327
1158516612_1158516616 18 Left 1158516612 18:58135881-58135903 CCGTGTTTCTTGAAGAAGACGTT 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1158516616 18:58135922-58135944 TGATGGCCATACCCCTTGTGTGG 0: 1
1: 0
2: 1
3: 3
4: 66
1158516612_1158516617 22 Left 1158516612 18:58135881-58135903 CCGTGTTTCTTGAAGAAGACGTT 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 75
1158516612_1158516619 27 Left 1158516612 18:58135881-58135903 CCGTGTTTCTTGAAGAAGACGTT 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1158516619 18:58135931-58135953 TACCCCTTGTGTGGTTGGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158516612 Original CRISPR AACGTCTTCTTCAAGAAACA CGG (reversed) Intronic
901444076 1:9296401-9296423 AGCCTTTTCTTCAAGAAGCATGG + Intronic
905601135 1:39252584-39252606 AAAATCTTTTTCCAGAAACAAGG + Intronic
908775791 1:67638603-67638625 AGCATCTTCTCCAAGAGACATGG + Intergenic
909622633 1:77684568-77684590 AACATCTACTTCAAGAAAAAGGG + Intergenic
909836593 1:80262145-80262167 AACAAATTCTTCAAGAAATATGG + Intergenic
916298534 1:163247700-163247722 AACCTTTTCTTCTAGAAAAATGG + Intronic
916728805 1:167548060-167548082 ACCAACTTCTGCAAGAAACATGG - Exonic
916773815 1:167938438-167938460 AACGTCTACTTAAAGAAGAAAGG - Intronic
916868853 1:168889937-168889959 AACGAAGTCTTCAAGAAATATGG + Intergenic
917146476 1:171897023-171897045 CACATCTTCTACATGAAACAGGG + Intronic
917148478 1:171918995-171919017 AATATTTTCTTCAAGAAAAAAGG - Intronic
919111144 1:193219960-193219982 AAAGTCTTCTACAAGAGTCAAGG + Intronic
919800852 1:201353819-201353841 AAAGGCTTCTTGGAGAAACAGGG + Intergenic
921940439 1:220833323-220833345 TCCCTCTTCTTCAAGAACCAAGG + Intergenic
922981819 1:229833429-229833451 AAAGTCTTCTTCAGCAAACCAGG - Intergenic
923364985 1:233250451-233250473 AATGTTCTCTTCAAGAAAGATGG - Intronic
1064950889 10:20848840-20848862 AATTTCTTCTTCAAGCAAAAAGG - Intronic
1066059602 10:31710179-31710201 AAATTATTCTTCCAGAAACATGG + Intergenic
1066174629 10:32891025-32891047 AATGTCTTTTTCAAGAGCCAAGG + Intergenic
1068745245 10:60522920-60522942 AACCTCTTCTACAAGAAAGATGG + Intronic
1070367846 10:75753442-75753464 AAAGTCCTCTTCAAAAAGCAGGG + Intronic
1070430635 10:76334296-76334318 AAAGTTTTCTACAAGAGACAGGG - Intronic
1071595448 10:86919402-86919424 AACATCCTCATCAAGAAAAATGG + Exonic
1075298463 10:121299077-121299099 AGCCTCTTCCCCAAGAAACAGGG - Intergenic
1076153476 10:128184243-128184265 AACTTTTTCTTCAAGACTCAAGG - Intergenic
1077656530 11:4024498-4024520 AATGTTTTCTTCAAGAAGTAGGG - Intronic
1077749173 11:4944892-4944914 AACATCTTTTTCAACAAACATGG + Intronic
1082837986 11:57665803-57665825 GACTTCATCTTAAAGAAACATGG + Intergenic
1086066976 11:82755732-82755754 AACGTTAGCTTAAAGAAACAGGG + Intergenic
1086525595 11:87722464-87722486 AACTATTTCTTCAAGAACCATGG - Intergenic
1089834947 11:121362328-121362350 AACATCCTCATCAAGAAAAATGG - Intergenic
1090273009 11:125401007-125401029 AAGGTCTTGTGCAAGAAAGATGG + Intronic
1091128347 11:133122359-133122381 AAAGTCTTCTCCAAGAAAAATGG + Intronic
1091176531 11:133563380-133563402 ATGGTCTTCTTGAAAAAACATGG - Intergenic
1091875608 12:3930778-3930800 AGCTTCTTCTTCAGGAAAAAGGG + Intergenic
1094691200 12:32771376-32771398 AACGTTTGCTTTAAGAAACAAGG + Intergenic
1096146782 12:49284039-49284061 AGCATCTTCAGCAAGAAACAGGG + Intergenic
1098687647 12:73444917-73444939 AATGTATTTTTCAAGAAGCACGG - Intergenic
1099388073 12:82042759-82042781 AACATATTCCTAAAGAAACAAGG + Intergenic
1102186643 12:110953299-110953321 AAAGTCTTTTTCAATAAAGAGGG - Intergenic
1102369104 12:112366510-112366532 AATGTCTTTTTTAAGAGACACGG - Intronic
1105443016 13:20430880-20430902 AAGGTATTTTTAAAGAAACACGG - Intronic
1108834247 13:54521039-54521061 AATGTCTTTCTCAAGAACCAGGG - Intergenic
1109387522 13:61651739-61651761 AAAGTCTTTTTCAAGAACCTGGG + Intergenic
1109737783 13:66509297-66509319 AATGTCTTTTTCAAGAACCTGGG + Intronic
1110946213 13:81422078-81422100 AACGAAGTCTTCAAGAAATATGG - Intergenic
1111438833 13:88250418-88250440 AAGGGCTTCTTGATGAAACATGG - Intergenic
1112315981 13:98362336-98362358 AATGGCTTCGTCAAGAAACTTGG - Intronic
1116906559 14:50409197-50409219 AAAGACTTCTTCAATAACCAGGG - Intronic
1118466515 14:66035874-66035896 CACATCTTCCCCAAGAAACATGG + Intergenic
1120249252 14:82042361-82042383 TTCATCTTCTCCAAGAAACAAGG - Intergenic
1122012552 14:98762899-98762921 CACGTATTCTTCAAAAAATAAGG + Intergenic
1122191437 14:100047153-100047175 AACGGCTTCCTGAAGAAACTGGG - Intronic
1124371254 15:29106098-29106120 AATGTCTTCAGCAAGAAACCAGG - Intronic
1126056610 15:44735735-44735757 AATATCTTCTACAAGAGACAGGG + Intronic
1126359332 15:47829898-47829920 AGCTTCCTCTTCAAGACACATGG + Intergenic
1127746901 15:61986881-61986903 AAAGTATCCTTCAAGAAATAAGG + Intronic
1128526624 15:68416617-68416639 ATCATCTTCTTCAAGAACAAGGG + Intronic
1130745051 15:86643710-86643732 AAAGTCAACTTCAAGAAAAAAGG - Intronic
1131021156 15:89100092-89100114 AATGTCTTCTACAGGTAACATGG - Intronic
1131023800 15:89122567-89122589 TCCATCTTCTTCCAGAAACAGGG - Intronic
1131089525 15:89612280-89612302 AATGTCTGATTCAAGAAACGAGG + Intronic
1131298016 15:91169290-91169312 AATGTCTTCTTTAAGAACCTGGG + Intronic
1131721561 15:95174247-95174269 AATGGCTTTTTGAAGAAACATGG - Intergenic
1131865922 15:96709599-96709621 AATGGCTTCTTCAAGAAAACTGG - Intergenic
1132424577 15:101704136-101704158 AACATCTTCTGAAAGAAACTAGG + Intronic
1134145709 16:11759803-11759825 AATTTCTTCTTTAAGAAAAAAGG + Intronic
1135461662 16:22649271-22649293 AAGGTCTTGTTCTAGAATCAGGG + Intergenic
1137246494 16:46710283-46710305 ATCTTCTTCACCAAGAAACAAGG + Intronic
1138803615 16:60065609-60065631 AACATCTTCACCAAGAAACAGGG + Intergenic
1141918613 16:87119647-87119669 AACCTCTTTTTCAAGCAACACGG - Intronic
1142307817 16:89295371-89295393 CACCTCATCTTTAAGAAACAAGG + Intronic
1143242817 17:5458361-5458383 ACTGTGTTGTTCAAGAAACAAGG + Intronic
1145183296 17:20771893-20771915 AACTTCTTCTGCAAGAAAAGGGG - Intergenic
1146324626 17:31875252-31875274 AAAGGCTTCTTCAAAAAGCATGG + Exonic
1148694041 17:49548515-49548537 AACCTGTTCTTCAGGAAGCAAGG - Intergenic
1150024455 17:61657949-61657971 TATGCCTTCTACAAGAAACACGG - Intergenic
1153334340 18:3906892-3906914 AATGTTTTCTTGAAGAAACAAGG - Intronic
1154500619 18:14995286-14995308 CACCTCTTCTTAAAGCAACAAGG - Intergenic
1156905222 18:42344550-42344572 AATGTCTTTTTCAAGAACCTGGG + Intergenic
1156937812 18:42732331-42732353 AACTTTTTCTTTAAGATACAAGG + Intergenic
1158516612 18:58135881-58135903 AACGTCTTCTTCAAGAAACACGG - Intronic
1158824141 18:61195349-61195371 AAAGTCTTCTTTAAAAAAGATGG + Intergenic
1158878539 18:61754649-61754671 AACCTCTTCCTCTACAAACAAGG - Intergenic
1159032207 18:63242980-63243002 ACGGTCGTCTTCAAGTAACATGG + Intronic
1160356547 18:78232094-78232116 TAAGTATTCTCCAAGAAACAAGG + Intergenic
928894949 2:36250442-36250464 AACATCATCTTCAGGAAACTAGG - Intergenic
930934449 2:56930609-56930631 AAACTCTTCTTCAACCAACATGG - Intergenic
934883718 2:98006268-98006290 AACGTTTTCTCCAAGAAATATGG + Intergenic
934895184 2:98112385-98112407 AAAGTGTTCTTCAAGAATGAAGG - Intronic
935012999 2:99153544-99153566 AACCTCTTCATCAAGAAACTAGG + Intronic
940101947 2:150050424-150050446 AATATCTTCTTCAAGGAAGAGGG - Intergenic
941546796 2:166861159-166861181 AACAGCTCTTTCAAGAAACATGG - Intergenic
942009517 2:171746164-171746186 AATGCATGCTTCAAGAAACAAGG - Intronic
945172760 2:207013849-207013871 GACTTCTTCTTCAAGAGACTTGG - Intergenic
946721964 2:222618452-222618474 CATGTCTTCTTCTAGAATCAAGG - Intronic
1170174654 20:13455099-13455121 AATGCCTTCTTAAAAAAACAGGG + Intronic
1173960335 20:47066452-47066474 AATGTCTTCAACAAGAAAGAAGG + Intronic
1175020297 20:55839943-55839965 AATCTCTTCTTCAAAAAAGAAGG - Intergenic
1175876861 20:62234421-62234443 AACCCCTTCCTCCAGAAACAAGG + Intronic
1178092160 21:29175854-29175876 AACTTCTTTTTCATTAAACATGG + Exonic
1179359482 21:40692508-40692530 TACGTCTGCTTCTAAAAACAAGG - Intronic
1181919729 22:26311331-26311353 AACCCCTTCTTCAAGAGTCAGGG - Intronic
1182450960 22:30420858-30420880 AACAACTTCTCAAAGAAACAGGG + Intronic
1183057577 22:35316322-35316344 AACGTTACCTGCAAGAAACAGGG + Intronic
1184215432 22:43063814-43063836 AACGTCGCCATCCAGAAACACGG - Exonic
1184310638 22:43639366-43639388 AAAGTCTCCTTCAAGAATGAAGG - Intronic
955513248 3:59701888-59701910 AACGACTTTTTTAAGAAACTAGG + Intergenic
956801573 3:72764367-72764389 AACGACTGCCTCAGGAAACATGG + Intronic
957864135 3:86000346-86000368 AAAATCTTTTTCAGGAAACATGG - Intronic
957877146 3:86161981-86162003 AACCTTTTCCTCAAGAATCATGG - Intergenic
959355426 3:105322034-105322056 GAGGTCTTGTTCAAGAAACAGGG + Intergenic
959561810 3:107790746-107790768 AAAGCCTCATTCAAGAAACACGG - Intronic
962846989 3:139281729-139281751 AAAGTCTTCTTCCAGAAGAATGG - Intronic
963025887 3:140918206-140918228 CACATCTTCATCAAGACACATGG + Intergenic
963646180 3:147917638-147917660 AACTCCTTCTTCAAAAAACTAGG - Intergenic
964739494 3:159950500-159950522 AACATCTCCTTCAATAAACTGGG - Intergenic
965568883 3:170151340-170151362 GACTTCTTATTCAAGCAACAAGG + Intronic
966005760 3:175009680-175009702 AATGTCTTCATCTAGAAGCAAGG - Intronic
967868519 3:194210262-194210284 TAGGTCTTCTGCCAGAAACAGGG + Intergenic
969470878 4:7388613-7388635 CACCTCTGCTTGAAGAAACATGG - Intronic
971826433 4:31629718-31629740 AAAGTTTTCTTCAACAAATATGG - Intergenic
972588268 4:40459297-40459319 ACTGTCTTTTGCAAGAAACATGG + Intronic
974194068 4:58548149-58548171 AATGTTTTCTTCAAGAAACCTGG + Intergenic
975243854 4:72094857-72094879 AACCTTTTCTCCAAGAACCACGG - Intronic
975876961 4:78852609-78852631 TTTGTCTTCTTCAAGAGACAAGG + Intronic
976663919 4:87570083-87570105 AATGTTTTCTTTAAAAAACAGGG - Intergenic
978646552 4:110939746-110939768 AATGTCTTGTTGTAGAAACATGG + Intergenic
982600830 4:157445827-157445849 AACGTCTTTCTCAAGAACCTGGG - Intergenic
982781879 4:159499899-159499921 AAAGTATGCTTCAAAAAACATGG + Intergenic
983775094 4:171596727-171596749 AATGTTTGCTTCAAGAAACAAGG + Intergenic
985854604 5:2415271-2415293 AAACTCTTCTTCAAGAACCCTGG - Intergenic
986329299 5:6705685-6705707 TCCAGCTTCTTCAAGAAACACGG + Intergenic
987822029 5:22977880-22977902 AATGTAATCATCAAGAAACACGG - Intergenic
988046097 5:25955848-25955870 AGTGACTTCTTCAAGAAACATGG - Intergenic
989433851 5:41387666-41387688 AATGTTTTCTTCAAGTAAAATGG + Intronic
990113955 5:52365726-52365748 AATGTCTCCTTCAAGAACCAAGG - Intergenic
990827442 5:59917102-59917124 AAAGACTTCTTCAAGAAGGATGG - Intronic
993414386 5:87608595-87608617 AATGTCTTCTAAAACAAACATGG - Intergenic
999332136 5:150681992-150682014 AAAGTCTTCTACAAGGAAAAAGG - Intergenic
1000851852 5:166350028-166350050 TTCTTCTTCTTCAAGAAAAAAGG - Intergenic
1000933509 5:167281006-167281028 AATGTCTGCTTCCAGAAAGATGG - Intergenic
1001456099 5:171860896-171860918 AACGTTTTCTACAAGAAAAACGG + Intergenic
1006124211 6:31827337-31827359 ACCGCCTCCTTCGAGAAACAAGG + Intergenic
1006277591 6:33018074-33018096 AACATTTTCTTTAAGGAACATGG - Intergenic
1007916537 6:45566689-45566711 CACCTCTTCGTCAAGACACAAGG + Intronic
1008256682 6:49310618-49310640 AAAGTATTCTTCAAGAATTAGGG + Intergenic
1008267217 6:49443279-49443301 AATGTCTTCCTCTAGAAAAATGG + Intronic
1009729882 6:67587602-67587624 AAAGAAGTCTTCAAGAAACATGG - Intergenic
1010521110 6:76838835-76838857 ACCGTCTTTTTAAAGAAAGATGG + Intergenic
1010666221 6:78632980-78633002 AACCTATTCTACAAGAAAAATGG + Intergenic
1010803221 6:80202194-80202216 CACCTCTTCTTCAAGACAAAGGG - Intronic
1011827416 6:91325791-91325813 AATGGCATCTTTAAGAAACAGGG - Intergenic
1012629883 6:101452191-101452213 AACACTTTCTTCAAGAAACATGG + Intronic
1014435404 6:121415500-121415522 AAAGTATTCTTCAAGAATGAAGG + Intergenic
1014640760 6:123906655-123906677 AAGGTCTTATTAAAGAAATATGG - Intronic
1015075959 6:129158001-129158023 AACATCCTCATCAAGAAAAATGG - Intronic
1015436773 6:133198869-133198891 AATGGCTTCTTCATGACACAGGG + Intergenic
1015675459 6:135742084-135742106 AACATCTTCTTCAAGCAGGAGGG + Intergenic
1016370697 6:143371320-143371342 AACTTTTTTTTTAAGAAACAGGG + Intergenic
1017133215 6:151125899-151125921 CACCTCTTCTTAAAGCAACAAGG - Intergenic
1017434162 6:154400123-154400145 CACAACTTCTTCATGAAACAAGG + Exonic
1019270623 7:145346-145368 AATGGCTTCAGCAAGAAACAAGG - Intergenic
1019839499 7:3426150-3426172 AAAGTTCTCTTCAAAAAACACGG - Intronic
1020591692 7:10147072-10147094 AAAGTCTTCTTCAGAAAATATGG - Intergenic
1020795219 7:12670778-12670800 CAAGTCTTTTTAAAGAAACATGG + Intergenic
1024275106 7:47671159-47671181 AACGTCTTCCTCAGGAACCCAGG + Intergenic
1027574157 7:79910629-79910651 AAAGTCTTCATCAATAGACATGG + Intergenic
1027898197 7:84072971-84072993 AACATCTTTTTCCAAAAACATGG + Intronic
1028623792 7:92854233-92854255 AACATTTTCTTTAAGAAACTTGG - Intergenic
1029224268 7:99013788-99013810 AACATCTTCTTCGAGGAAGATGG + Intergenic
1031274148 7:119696638-119696660 AACCTCTTATTTAAGAAAAACGG - Intergenic
1032221006 7:129994207-129994229 ATGGTCTTCTTTAAGAGACAGGG + Intergenic
1032425466 7:131819147-131819169 AATGTCTTCTTCAAGAACCTGGG - Intergenic
1032998291 7:137474054-137474076 CACTTCTTCTTAAAGGAACAAGG - Intronic
1037020833 8:13968237-13968259 AAAGTTTTCTGCAAGGAACATGG - Intergenic
1037279436 8:17220481-17220503 AACATCTTCTCCAAAAAACTTGG + Exonic
1037281112 8:17243529-17243551 AACCAGTTCTTCAAGAAACTTGG - Intronic
1038320712 8:26524372-26524394 AATGTCATCTACAATAAACATGG - Intronic
1042713739 8:71748235-71748257 AAAGTCTCCATCAGGAAACAAGG - Intergenic
1043790450 8:84460514-84460536 AAAATGTTCTTCAAGATACAAGG + Intronic
1044223108 8:89692646-89692668 AACATTTTCTACAATAAACAAGG - Intergenic
1046282222 8:112048613-112048635 CACCTCTTCTTCAAAAAACCAGG - Intergenic
1046654495 8:116877990-116878012 AACGTCTTCACCATGCAACATGG - Intergenic
1047420535 8:124704509-124704531 AACCACTTGTTCATGAAACATGG + Intronic
1048108792 8:131443245-131443267 AACATCTTTTTCAAGGAGCAGGG + Intergenic
1049722712 8:144127180-144127202 AGCTTCTACTTCAAGAAACTAGG + Intergenic
1051538935 9:18192604-18192626 AATGTCTTCTCCAAAAATCATGG - Intergenic
1053213010 9:36247358-36247380 AATGTTTTCTTAAAGAAAAAAGG - Intronic
1057968377 9:99527208-99527230 AACGTGTATTTCTAGAAACAAGG - Intergenic
1187237171 X:17478215-17478237 AAAGTCTTCTTCATGACACAAGG - Intronic
1192213821 X:69144156-69144178 AAGCTCTGCTTCCAGAAACAAGG - Intergenic
1192657216 X:73003913-73003935 AACGTCTTCATCAAGAACCTGGG + Exonic
1192664904 X:73079094-73079116 AACGTCTTCATCAAGAACCTGGG - Exonic
1193478841 X:82000985-82001007 AAAGTCTTCTTTGAGAAATATGG - Intergenic
1195287508 X:103399222-103399244 AATGACTTCTCCCAGAAACAAGG + Intergenic
1197400554 X:125984037-125984059 GACTTCTCCTTCAAGAAAAAGGG + Intergenic
1199082573 X:143593070-143593092 TTCCTCTTCTTCCAGAAACATGG - Intergenic
1199472947 X:148215138-148215160 AATGTCAGCTCCAAGAAACATGG - Intergenic
1200297043 X:154930510-154930532 AACTACTTCATCAAAAAACATGG - Exonic