ID: 1158516617

View in Genome Browser
Species Human (GRCh38)
Location 18:58135926-58135948
Sequence GGCCATACCCCTTGTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158516611_1158516617 23 Left 1158516611 18:58135880-58135902 CCCGTGTTTCTTGAAGAAGACGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 75
1158516612_1158516617 22 Left 1158516612 18:58135881-58135903 CCGTGTTTCTTGAAGAAGACGTT 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158516617 Original CRISPR GGCCATACCCCTTGTGTGGT TGG Intronic
901192795 1:7422478-7422500 GGCCAGACCCCCTCTGTGCTGGG + Intronic
902954165 1:19913439-19913461 AGCCAGAGCCCTTGTGTGGATGG - Intergenic
903888861 1:26556729-26556751 GGCCAGAGCCCTGGTGTGGGTGG - Intronic
911686712 1:100785884-100785906 GGCCAGAACCATTCTGTGGTTGG + Intergenic
911872222 1:103112468-103112490 GGCCATATTCCTTGTTTGTTTGG - Intergenic
912495730 1:110089948-110089970 GGCCATAGCCCTTGGGAGATGGG + Intergenic
916899345 1:169203615-169203637 GGCCAGAACCATTCTGTGGTTGG + Intronic
920279250 1:204830353-204830375 GGCCATACCAGCTGTGAGGTGGG + Intronic
1063102588 10:2963333-2963355 GGCCACACACCTGGTGGGGTGGG + Intergenic
1063540384 10:6927820-6927842 AGCCTTAGCCCTTGGGTGGTGGG - Intergenic
1063862492 10:10326663-10326685 GGCCATGCCCCACGTGTGGATGG - Intergenic
1070682412 10:78457669-78457691 AGCTATACCCCTTGGATGGTAGG + Intergenic
1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG + Intronic
1082079058 11:47997734-47997756 GGGCATATCTCTTGTGTGGAAGG - Intronic
1091155182 11:133365594-133365616 GTCCATACCTCATGTATGGTAGG + Intronic
1091789076 12:3260956-3260978 AGCCATATCCCTTGGGTTGTAGG + Intronic
1100074255 12:90759551-90759573 GTCCATACACCTGGTGTTGTTGG - Intergenic
1102632491 12:114293497-114293519 GGCAATACCTGTTGTGTGCTAGG + Intergenic
1107721586 13:43253898-43253920 AGCCATACCTCTTGTGAGGCAGG + Intronic
1122348666 14:101075575-101075597 GGCCACACCCCCTCTTTGGTGGG + Intergenic
1122717620 14:103705171-103705193 GGCCACATCCCTTTTGTGGCTGG + Intronic
1132623210 16:878024-878046 AGCCAGACCCCATGTGTGTTTGG - Intronic
1140184122 16:72751481-72751503 GGTCATCCACCTTGTGTGGAAGG - Intergenic
1150894983 17:69199087-69199109 TGCCATATCCCCTGTGTGGAAGG + Intronic
1152095058 17:78267913-78267935 GGCCATTGCCCTTTTCTGGTGGG + Intergenic
1153316444 18:3727262-3727284 GGGCAGACCCCATGTGTGTTTGG + Intronic
1153967382 18:10194302-10194324 GGCCATGCCTGTTGTGGGGTGGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1158647743 18:59262986-59263008 GGCCATGCTCCTTGAGTGTTAGG + Intergenic
1161156939 19:2736847-2736869 GTCCAAACCCCTTGTTTGGCCGG + Intronic
1161840065 19:6674741-6674763 GCCCATACCCCTGGAGTTGTGGG + Intergenic
1164696236 19:30246581-30246603 TGCCAGACCTCTTGTGGGGTGGG - Intronic
1164939792 19:32243606-32243628 TGCCTTAGCCCTTGTTTGGTTGG + Intergenic
926137290 2:10345875-10345897 GTCCTTGCCCCTTTTGTGGTGGG - Intronic
926634611 2:15166156-15166178 GGGAACACCCCTTGTGTGGGAGG + Intergenic
932609255 2:73186769-73186791 GGACATAAACATTGTGTGGTAGG - Intergenic
948983314 2:241506007-241506029 GGTCATTCCCCTTGTTTTGTGGG - Intronic
1173842675 20:46168306-46168328 GGCTTAACCCCTTGTGTGCTGGG - Intergenic
1176407848 21:6431179-6431201 GGCCATGCCCGTCGTGTGCTGGG + Intergenic
1176867704 21:14063175-14063197 GGCGATACCCCTCCAGTGGTGGG + Intergenic
1179683339 21:43039510-43039532 GGCCATGCCCGTCGTGTGCTGGG + Intergenic
1184615385 22:45634498-45634520 TGCCAACACCCTTGTGTGGTGGG + Intergenic
1184735776 22:46396996-46397018 GGCCATTCCCCATGTGTCCTGGG - Intronic
950113865 3:10438100-10438122 GCCCATACCCACTGTGTGCTGGG + Intronic
959041968 3:101432149-101432171 GGCCATACTCCTTGTGGCCTGGG + Intronic
962703628 3:138022678-138022700 GGCAAGGCCCCTAGTGTGGTTGG - Intronic
969441881 4:7222058-7222080 GCCCTTTCCCCTTGTCTGGTGGG - Intronic
974021045 4:56692773-56692795 GGCCATGGTCCTTGTGTGCTTGG - Intergenic
977661649 4:99594829-99594851 GGCCATTCCCATTGTGGGGCAGG + Exonic
978441482 4:108738729-108738751 GGTCATCCACCTTGTGTGGAAGG + Intergenic
983389697 4:167113768-167113790 GTCCATAGCCCTTGTGCGGTGGG - Intronic
987270656 5:16305011-16305033 GGCCAGACCCACTTTGTGGTCGG + Intergenic
987284438 5:16441572-16441594 GGCCCTACCCCTTCTGCAGTTGG - Intergenic
997288263 5:132699985-132700007 GTCCATGCCCCTCTTGTGGTGGG + Intronic
998558299 5:143147402-143147424 GACCAAAGCCCTTGTGGGGTAGG - Intronic
1000187488 5:158873727-158873749 GGCCAAAGTCCTTGTTTGGTGGG - Intronic
1001308590 5:170594386-170594408 GGCCATACCCCTCTTCTGGTGGG - Intronic
1002537303 5:179883892-179883914 GGCCTTTCCCCTGCTGTGGTCGG + Intronic
1004395747 6:15245472-15245494 GGCCATAGCCATTTTGTAGTCGG + Intergenic
1008875981 6:56328411-56328433 TGCCATACCACTAGTGTGATGGG - Intronic
1017882646 6:158572507-158572529 GGCCACACCCCTTTTGTCGATGG + Intronic
1023890883 7:44391246-44391268 GGACATGCCCCTGGTGTGGCAGG + Intronic
1024204904 7:47149619-47149641 TGTCATACACCTGGTGTGGTGGG + Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1030874136 7:114792429-114792451 TGCCAGACCCCTGGAGTGGTGGG - Intergenic
1035067958 7:156121769-156121791 AGCCACCCCGCTTGTGTGGTGGG + Intergenic
1035755364 8:2027051-2027073 GGATAGAGCCCTTGTGTGGTAGG - Intergenic
1043653536 8:82631471-82631493 GGCCACAGCTCTTGTTTGGTTGG + Intergenic
1046594783 8:116248595-116248617 GGCCATACAACCTGTGTGTTTGG + Intergenic
1052751674 9:32498148-32498170 GGCCAGACCCACTCTGTGGTTGG - Intronic
1054843898 9:69772098-69772120 GGCAATACCCCTTGGGTTTTGGG - Intergenic
1056964102 9:91151939-91151961 GCTCAGTCCCCTTGTGTGGTTGG - Intergenic
1057063405 9:92026203-92026225 GGCCCTACCCCTTGGGAGGAGGG - Intergenic
1060406479 9:123375495-123375517 GGAAATACCTCTTGTGTGGGGGG - Intronic
1061959461 9:133980546-133980568 GGCCATGCCCCATGGCTGGTCGG - Intronic
1186066914 X:5776223-5776245 GGGTATACCCCTTGTATGTTGGG - Intergenic
1190302205 X:49063658-49063680 GCCCAAACCCCTGGGGTGGTGGG - Intronic
1191217771 X:57951389-57951411 GGCCAGAAGCCTTGTTTGGTGGG - Intergenic