ID: 1158517102

View in Genome Browser
Species Human (GRCh38)
Location 18:58139794-58139816
Sequence CCACCGTAGAACCCCCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158517099_1158517102 1 Left 1158517099 18:58139770-58139792 CCCAAAGGGAGGAAGCTCAGGAA 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1158517102 18:58139794-58139816 CCACCGTAGAACCCCCTAAAAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1158517100_1158517102 0 Left 1158517100 18:58139771-58139793 CCAAAGGGAGGAAGCTCAGGAAA 0: 1
1: 0
2: 4
3: 37
4: 340
Right 1158517102 18:58139794-58139816 CCACCGTAGAACCCCCTAAAAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1158517097_1158517102 4 Left 1158517097 18:58139767-58139789 CCTCCCAAAGGGAGGAAGCTCAG 0: 1
1: 0
2: 2
3: 31
4: 224
Right 1158517102 18:58139794-58139816 CCACCGTAGAACCCCCTAAAAGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158517102 Original CRISPR CCACCGTAGAACCCCCTAAA AGG Intronic
905631960 1:39523847-39523869 TCACCGTTGAACCTCCTAAGAGG - Intronic
905665801 1:39762345-39762367 TCACCGTTGAACCTCCTAAGGGG + Intronic
924095342 1:240545253-240545275 CCTCCGCAAAACCCCCCAAAAGG + Intronic
1064356542 10:14624056-14624078 CCACCGTACTGACCCCTAAAGGG + Intronic
1075980271 10:126732451-126732473 CCAGCGTTCAACCCCCTACAGGG + Intergenic
1077546937 11:3176018-3176040 CCTCCTCAGAACCCCCTAAATGG - Intergenic
1077702709 11:4456562-4456584 CCACCTTACAACTCCCTAACAGG + Intergenic
1078599526 11:12717877-12717899 CCACTGTACAACCCAGTAAATGG - Intronic
1083949368 11:65945634-65945656 GCACCGTAGAACTGCCTAACAGG - Exonic
1084335595 11:68455767-68455789 CCACCGGGGAACCCCCTCACTGG + Intergenic
1089505355 11:118958569-118958591 CCAAGGTAGAGCCCACTAAAGGG - Intergenic
1099980704 12:89598687-89598709 CCGCCTTAGAGCCCCCTGAATGG + Intronic
1115846010 14:37535683-37535705 CTACAGTAGAAACACCTAAAAGG + Intronic
1116802311 14:49455636-49455658 CTGCCCTAGAACCCCCAAAAAGG + Intergenic
1117666304 14:58060031-58060053 CCACCCTAGAACCTGCAAAAAGG + Intronic
1120938594 14:89922869-89922891 CCACCTTGCAACCCCCAAAAAGG - Intronic
1123896939 15:24838919-24838941 CCACCATAAAACCCCAGAAAGGG - Intronic
1136276676 16:29182915-29182937 CCACCGTAGCACGTCCTCAAGGG + Intergenic
1142080461 16:88146291-88146313 CCACCGTAGCACATCCTCAAGGG + Intergenic
1158517102 18:58139794-58139816 CCACCGTAGAACCCCCTAAAAGG + Intronic
937253047 2:120536119-120536141 CCACCGTGCAGCCCCCTTAAAGG + Intergenic
938743503 2:134254809-134254831 CCAGCTCAGAACCCCCAAAATGG - Intronic
1174657215 20:52181632-52181654 CCACAGTCCAACCCCCCAAATGG - Intronic
1182618554 22:31605009-31605031 CCTCAGCAGGACCCCCTAAAAGG - Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
972343153 4:38170326-38170348 ACAGCGTAAAACTCCCTAAAGGG - Intergenic
980949572 4:139360073-139360095 CCATTGTACAACCCTCTAAATGG - Intronic
990925236 5:61014243-61014265 CCTCCGTGAAAACCCCTAAATGG + Intronic
991437686 5:66613549-66613571 TCACAGTAGAGCCCCCTACATGG + Intronic
995753904 5:115481529-115481551 CCACCCTAGACCCTCCTATAAGG + Intergenic
1003189048 6:3856889-3856911 CCAGCGTAGGACCCCTTAACAGG - Intergenic
1007246239 6:40465216-40465238 CTACCCTAGAGCCCCCTGAAAGG + Intronic
1019886589 7:3911065-3911087 CCACCCTAGTCCCCCCAAAATGG - Intronic
1021102175 7:16596693-16596715 CAACCATAAAACCACCTAAAAGG + Intergenic
1023097614 7:36678161-36678183 CCACAGTAGCACCCCTAAAAAGG - Intronic
1033672415 7:143505669-143505691 ACACCTTAGAATCACCTAAAGGG + Intergenic
1040849873 8:51888467-51888489 CCACAGTAGAAGGCACTAAAGGG + Intronic
1041024541 8:53670314-53670336 CCACCGTGGAACCCACAGAAGGG - Intergenic
1047570473 8:126093570-126093592 CCACCCTAGAACCACATGAATGG - Intergenic
1186939883 X:14494780-14494802 CTCCCGTAGAAGCACCTAAATGG + Intergenic
1188310649 X:28612526-28612548 CCAGAGTAGCACCCCCTAAAGGG + Intronic
1193773681 X:85618720-85618742 CCATGTTAGAACCCCCTTAAGGG + Intergenic
1199250440 X:145655694-145655716 CCACTGGAGAACCCCATATAAGG + Intergenic