ID: 1158519614

View in Genome Browser
Species Human (GRCh38)
Location 18:58160902-58160924
Sequence ACATGTAGGCAACAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158519614 Original CRISPR ACATGTAGGCAACAGCTGGG AGG (reversed) Intronic
903214764 1:21837683-21837705 ACATGCAGGGGACAGATGGGAGG + Intronic
904594219 1:31632886-31632908 CCCTGTAGGAAACAGCAGGGAGG - Intronic
904799431 1:33082140-33082162 AGATGAAGGGAACCGCTGGGGGG - Intronic
905444030 1:38013184-38013206 TCATGTAGGCAACAACTGCTGGG + Intronic
906271289 1:44481093-44481115 AGATGTAGACAACACCTTGGAGG + Intronic
909077899 1:71075189-71075211 ACATGTAGAAACCAGCTAGGTGG + Intronic
909102152 1:71361669-71361691 ATATTCAGGCAAAAGCTGGGTGG - Intergenic
911091378 1:94019855-94019877 ACCTGGAGGCCACACCTGGGCGG - Intronic
914952030 1:152124639-152124661 ACCTGTTGGCACAAGCTGGGAGG + Intergenic
915602673 1:156932125-156932147 ACATGTAGCCCAAAGATGGGAGG - Intronic
916457934 1:164990307-164990329 TCATGTACACAACACCTGGGAGG + Intergenic
917364252 1:174211710-174211732 TCATGTAGGCAACAGATCAGTGG - Intronic
917901593 1:179548154-179548176 ACATGGAGGCAACATGTGGAGGG + Intronic
920436756 1:205951903-205951925 ACATCTAGGCTCCAGCTGGCAGG - Intergenic
922863391 1:228838336-228838358 ACTTGTAAGAAGCAGCTGGGTGG + Intergenic
922883849 1:229003225-229003247 AAATTCAGGCAAAAGCTGGGTGG + Intergenic
923513560 1:234674496-234674518 AACTGTAGCCATCAGCTGGGTGG + Intergenic
924176571 1:241397321-241397343 AGTTGTAGGCAAGAGCTGTGCGG - Intergenic
1062884073 10:1003663-1003685 AAATGTTGGCAATAACTGGGTGG + Intronic
1063650394 10:7930266-7930288 ATATGTAGGTAAGAGGTGGGTGG + Intronic
1067478867 10:46582812-46582834 ACATGTTCTCAAGAGCTGGGTGG + Intronic
1067615871 10:47758989-47759011 ACATGTTCTCAAGAGCTGGGTGG - Intergenic
1069717205 10:70529007-70529029 AAATGTAGTCTTCAGCTGGGTGG + Intronic
1071564292 10:86663669-86663691 ACATGGAGGCAGCAGCTGTGTGG + Exonic
1074432792 10:113408160-113408182 TCCTGCAGACAACAGCTGGGGGG + Intergenic
1075049813 10:119175220-119175242 GCATGTAGGAAACAGCAGGAAGG + Intronic
1079288634 11:19165081-19165103 CCATGTATGCAACTGCTGTGTGG + Exonic
1080351377 11:31389238-31389260 TCTTGTAGGCAACAGATGGTTGG - Intronic
1080896051 11:36449551-36449573 ACCTGTCTGCATCAGCTGGGAGG - Intronic
1083593225 11:63907250-63907272 TCATGCAGTCAACAGCTGGGTGG - Intronic
1085885713 11:80519389-80519411 ACATCTAGGAAACAGCTGTCGGG + Intergenic
1087626649 11:100603714-100603736 ACCTGGAGGCCCCAGCTGGGAGG - Intergenic
1090254596 11:125274614-125274636 ACATGTCGGCTGCAGCTAGGAGG + Intronic
1091067560 11:132530461-132530483 ACATGTAGGGAATAGATTGGAGG - Intronic
1093707102 12:22286548-22286570 ACATGTAGGCAGCAAGAGGGGGG - Intronic
1095576101 12:43741184-43741206 ACATTTAAGCAAAAGCTGGATGG - Intronic
1096850510 12:54432682-54432704 ACAAGTGAGCAACAGCTGGATGG - Intergenic
1097184863 12:57191097-57191119 ACATGGTGGGAACAGCTGGGAGG + Intronic
1098042576 12:66367313-66367335 AATCATAGGCAACAGCTGGGTGG - Intronic
1099148160 12:79074288-79074310 CCATGTAGACCACAGCTGTGTGG - Intronic
1100087190 12:90925955-90925977 TCATGGGGGCAACAGCTGCGGGG - Intronic
1100332435 12:93597080-93597102 AGATGTAGCCAACCACTGGGGGG - Intergenic
1101399831 12:104377653-104377675 ACAGGAAGGACACAGCTGGGAGG + Intergenic
1101801835 12:108029192-108029214 GCATGAAGTCAGCAGCTGGGAGG + Intergenic
1104395570 12:128429558-128429580 ACCTGCAGCCAACATCTGGGAGG - Intronic
1106697024 13:32185944-32185966 ATATGTAAGCAGCAGCTGAGTGG + Intronic
1112950688 13:104992488-104992510 CAATGTAGGGAACAGCTGAGAGG - Intergenic
1113871165 13:113560734-113560756 CAATGTAGGCAGAAGCTGGGAGG + Intergenic
1120461263 14:84799215-84799237 ACATGTAATTAACAGCCGGGTGG - Intergenic
1121870195 14:97400287-97400309 TCATTTAGGAATCAGCTGGGTGG + Intergenic
1122175803 14:99917932-99917954 ACATGTAGCCAAGAGCTGAACGG - Intronic
1202857208 14_GL000225v1_random:58873-58895 GCACCTAGGCAAAAGCTGGGAGG + Intergenic
1126801652 15:52303514-52303536 AAATGCAGTCAACAGGTGGGGGG - Intergenic
1127789372 15:62385342-62385364 AGATGTCTGCCACAGCTGGGAGG + Intergenic
1128440575 15:67704654-67704676 ATATGTATGCATCAGCTGAGAGG + Intronic
1131332014 15:91509633-91509655 CAATGTAAGCAACAGCTGGGAGG - Intergenic
1133972298 16:10577080-10577102 AGATCTAGGCCACAGCTGAGGGG - Intronic
1137603912 16:49774648-49774670 AGAAGTAAGCAACAGGTGGGTGG + Intronic
1141241246 16:82266984-82267006 ACATTTAAGCAACTGCTGGGGGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1144686117 17:17227383-17227405 ACATGAAGGCCACGGCAGGGAGG + Intronic
1145785422 17:27590767-27590789 ACATGTTTGCACCAGCTGGGAGG - Intronic
1146525776 17:33565830-33565852 ACATCTAGGTAACAGCTTGAAGG + Intronic
1148860287 17:50601020-50601042 GCATGGAGGCAACGGCTGAGAGG - Intronic
1149356229 17:55842564-55842586 ACAGGTTGGCATCAGCTTGGAGG + Intronic
1153027035 18:681371-681393 TCATGTAAGCAAAACCTGGGAGG + Intronic
1153073306 18:1131817-1131839 AGCAGTTGGCAACAGCTGGGGGG - Intergenic
1158425905 18:57339429-57339451 AACTGCAGGCAACACCTGGGAGG + Intergenic
1158498065 18:57974481-57974503 ACATGCAGGCATCATCTGGGAGG + Intergenic
1158519614 18:58160902-58160924 ACATGTAGGCAACAGCTGGGAGG - Intronic
1159289216 18:66395360-66395382 AAATGTAAGCAACACCTGGAAGG + Intergenic
1159710539 18:71752509-71752531 AAATGTTGGCAATAGCTGGTAGG - Intronic
1163084275 19:14968313-14968335 CCATGAAGGCATCAGCTGTGGGG + Exonic
1163416062 19:17187214-17187236 ACAGGCAGAGAACAGCTGGGTGG - Intronic
1163737048 19:18988001-18988023 AAATGTAGCCAACAGCTTGCAGG - Intergenic
1164798825 19:31058805-31058827 ACATGTGAGCAACTTCTGGGTGG - Intergenic
1165722738 19:38091047-38091069 ACATATGGGCAACTGCTGGGTGG + Intronic
1166621089 19:44301189-44301211 ACAAGTAGGAAACAGGTGCGGGG - Intronic
1166647245 19:44541244-44541266 ACATGGAGGGAACAGCTCTGAGG - Intergenic
1166696858 19:44856765-44856787 TCCTGGGGGCAACAGCTGGGTGG - Intronic
1166853057 19:45769484-45769506 ACAGCTGGGCCACAGCTGGGCGG + Intergenic
925148402 2:1598557-1598579 ACATGCAGGCACCGGCTGCGTGG + Intergenic
936416117 2:112313767-112313789 ACATGGAGGCCACAGCAGAGTGG + Intronic
936492430 2:112983688-112983710 GCAGGTAGGCAGGAGCTGGGTGG + Intronic
937039109 2:118807453-118807475 TCATTCAGGCAACAGCTGGAAGG + Intergenic
937265332 2:120611701-120611723 CCATGAAGGCAAGAGCTGGAAGG - Intergenic
938196919 2:129336463-129336485 TCATGTAGGACACAGCTGGTAGG + Intergenic
938499080 2:131820992-131821014 ACATGAAGGCCACACCTGGCAGG + Intergenic
941014881 2:160344256-160344278 ACTTGTAAGCAGCAACTGGGGGG + Intronic
948706171 2:239794045-239794067 ACATGAAGGCCACAGCATGGTGG - Intronic
1170358704 20:15520748-15520770 ACATGTATGAAACAGCAGGTGGG + Intronic
1180228988 21:46414909-46414931 ACATTTAGCAAACAGCAGGGAGG - Intronic
1181138680 22:20787630-20787652 ACAGGGAGGCAACAGCAGGAGGG - Exonic
1181489246 22:23251383-23251405 GCACGTCGGCAACACCTGGGAGG - Intronic
1184081478 22:42224141-42224163 ACATGCAGGCAAAAACTAGGGGG + Intronic
1184687546 22:46103478-46103500 ACATGGAGACCACTGCTGGGCGG + Intronic
949777744 3:7651387-7651409 ACATCTCTGCAACAGCAGGGAGG - Intronic
954131112 3:48561358-48561380 ACATGAAGGCAGACGCTGGGTGG - Intronic
954793922 3:53151861-53151883 ACAGGCATGCAACAGCAGGGAGG + Intergenic
956884292 3:73543364-73543386 AGATGTAGGCAGCACCTGAGAGG + Intronic
959501322 3:107108829-107108851 ACATGAAGGCACCATCTTGGAGG - Intergenic
960638502 3:119806902-119806924 TCATGGAGGCCACAGCTGAGTGG - Intronic
963411557 3:144934032-144934054 TCATGTAGGCAACAGATTGGTGG - Intergenic
965480795 3:169217067-169217089 ACAAGTAGGTAACAGGAGGGTGG + Intronic
966118456 3:176494014-176494036 AGATATAGGCAATGGCTGGGGGG + Intergenic
966636177 3:182136269-182136291 ACATGTAAACAGCATCTGGGAGG - Intergenic
971375345 4:26051555-26051577 ACATGTGTGCAGCAGCTGAGTGG + Intergenic
972106007 4:35487947-35487969 AAATGTAGGCAAGATCTGTGTGG + Intergenic
973340624 4:48999806-48999828 ACATGGACCCTACAGCTGGGTGG - Intronic
974155284 4:58063571-58063593 ACCTGCAGGCTACAGCTGGATGG - Intergenic
976312915 4:83630298-83630320 AAATGTAGGCTATCGCTGGGTGG - Intergenic
984641150 4:182165542-182165564 ACACATAGTCATCAGCTGGGAGG + Intronic
985351241 4:189064383-189064405 ATATGTATGCAACAGCTGTTAGG - Intergenic
986504102 5:8430654-8430676 TCATGCAGGCCACTGCTGGGAGG - Intergenic
986831144 5:11579904-11579926 ATATGTAGGGAACAGCTGCCGGG - Intronic
987275858 5:16361809-16361831 TCAAGTAGGCAACAGTTAGGAGG + Intergenic
987911880 5:24157504-24157526 ACTTGTAGGCAACAGATCAGTGG - Intronic
991469012 5:66947712-66947734 ACATGTTGGCAAAACCTGGTTGG + Intronic
992783657 5:80150204-80150226 ACAAGTATGAAACAGGTGGGTGG + Intronic
995273877 5:110256514-110256536 ACATGTGGCCAGGAGCTGGGTGG + Intergenic
995802544 5:116013908-116013930 ACATGTATGTAACAGCCAGGAGG + Intronic
999663661 5:153891237-153891259 AAATGTAGTGAGCAGCTGGGTGG - Intergenic
1001887206 5:175303652-175303674 ACATTTAGGCAACAACTTGAAGG + Intergenic
1002125601 5:177041328-177041350 GCATGGAGGCAACATCTGGGTGG - Intronic
1004848338 6:19670390-19670412 ACAAGCAGGCAAGATCTGGGAGG - Intergenic
1005186571 6:23168840-23168862 ACAAGGAGGCTACAGATGGGAGG - Intergenic
1005898579 6:30198343-30198365 GCAAGTAGGCGGCAGCTGGGAGG - Intronic
1007113211 6:39325466-39325488 ACATGTAGGCACCACCTGGAAGG + Intergenic
1007304195 6:40891658-40891680 ACATGCTGGCACCAGCTGAGAGG + Intergenic
1007693121 6:43715756-43715778 AAAAGTAGGCAACAGCTTGGGGG + Intergenic
1008900900 6:56614718-56614740 ACATTGATGGAACAGCTGGGAGG - Intronic
1009245681 6:61234204-61234226 ACTTGTAGGCAACAGATTGATGG - Intergenic
1010495949 6:76533566-76533588 ACGTGAAGGCAACAGCAGGGAGG + Intergenic
1011225885 6:85106416-85106438 TCTTGTAGGCAACAGATAGGTGG + Intergenic
1012206343 6:96465464-96465486 ACATGGTGGCAAGAGCTTGGAGG - Intergenic
1012331721 6:97998877-97998899 AGAAGTAGGTAACAACTGGGTGG - Intergenic
1013073304 6:106748694-106748716 GCATGTAGGGAACAGATGGAGGG - Intergenic
1013318117 6:108960714-108960736 GCATGTAAGCAACTGCTAGGAGG + Intronic
1014708764 6:124781460-124781482 ACATCCTGGTAACAGCTGGGAGG - Intronic
1018437540 6:163776392-163776414 GCATTTAGTTAACAGCTGGGAGG - Intergenic
1018688754 6:166325876-166325898 ACATTTAGCCACCAGCTGGGTGG + Intronic
1019514618 7:1434268-1434290 TCCTGCAGGCAAGAGCTGGGAGG + Intronic
1020455092 7:8363415-8363437 ACATAAGGGAAACAGCTGGGGGG + Intergenic
1022044234 7:26610635-26610657 ACATGTAGGAGCCAGCTGGAGGG + Intergenic
1024488276 7:49945747-49945769 TCATGTAGGCAACAGATTGTTGG + Intronic
1027247166 7:76375049-76375071 ACATGTAGGCAGCAGAGGAGAGG + Intergenic
1028184699 7:87768749-87768771 CCATGCAGGAAACAGCTGGGAGG - Intronic
1028559188 7:92154839-92154861 GTTTGTAGGCATCAGCTGGGGGG - Intronic
1028843323 7:95452177-95452199 AAATGTTGACAACAGCAGGGAGG - Intergenic
1029359415 7:100077662-100077684 TCAGGGAGGCAACAGGTGGGAGG - Exonic
1030673184 7:112359536-112359558 ACATGTGGTCACCAGCTGGGTGG + Intergenic
1031554013 7:123149222-123149244 ATATGTAGGAAACATGTGGGAGG - Intronic
1033286048 7:140041301-140041323 ACACATAGGCACCAGCTGTGGGG + Intronic
1033691501 7:143741747-143741769 TCTTGTAGGCAACAGATGAGTGG - Intergenic
1035717839 8:1767359-1767381 ACAGGTAAGCCACAGCTGAGTGG - Intronic
1038930677 8:32190423-32190445 AAATAAAGGCAACAGCTGTGAGG + Intronic
1040886495 8:52269139-52269161 AGATGTAGGCCAATGCTGGGCGG + Intronic
1041686321 8:60648148-60648170 ACATCTAGGGAACAGCATGGAGG - Intergenic
1045245479 8:100438430-100438452 GCATGTAGGCGACAGATGGGAGG - Intergenic
1045543626 8:103109064-103109086 ACATGCAGCCCACAGCTGGCGGG + Intergenic
1046466248 8:114607786-114607808 ACATGTAGCAAAAAGCTGGCAGG - Intergenic
1046748025 8:117896941-117896963 ACATGGAGGCAGAGGCTGGGGGG - Intronic
1050428440 9:5536452-5536474 ACATCCAGGCAGCAGCTGGGAGG + Intronic
1050647788 9:7740332-7740354 ACAGGGAGGCAACAGATGAGAGG + Intergenic
1051258352 9:15236048-15236070 ACTTGTAGGCAGCAGATGGTTGG - Intronic
1051500544 9:17771770-17771792 TCAAGTAGGAAACAGCAGGGAGG - Intronic
1053875411 9:42540539-42540561 TCATGCAGGCTACAGCAGGGAGG + Intergenic
1053897232 9:42754096-42754118 TCATGCAGGCGACAGCAGGGAGG - Intergenic
1054236289 9:62561185-62561207 TCATGCAGGCTACAGCAGGGAGG - Intergenic
1055227590 9:74017858-74017880 TCTTGTAGGCAACAGATTGGTGG - Intergenic
1059446495 9:114341570-114341592 AGATGTAGGCAAAGGCTGGAGGG + Exonic
1062208371 9:135349510-135349532 AGCTGTAGGCATCAGCTGCGTGG + Intergenic
1062276969 9:135735872-135735894 ACAGGCAGGTAACAGCCGGGGGG - Intronic
1188475920 X:30592113-30592135 ACATGTAGGTAACAGTGAGGAGG + Intergenic
1191803505 X:65107263-65107285 AAATGTAGGCAAAAGCTTTGTGG + Intergenic
1191889350 X:65925047-65925069 AGATGGAGGCCCCAGCTGGGAGG + Intergenic
1192550366 X:72048674-72048696 TCCTGTAGGCAACACCAGGGCGG + Intergenic
1195393633 X:104388337-104388359 ATATGTAGGCTACAGATGGAAGG - Intergenic
1198028303 X:132730586-132730608 CCACGTGGGCAACAACTGGGAGG + Intronic
1201783880 Y:17752252-17752274 ACATATATGCAACAGAAGGGAGG - Intergenic
1201817673 Y:18153735-18153757 ACATATATGCAACAGAAGGGAGG + Intergenic