ID: 1158524301

View in Genome Browser
Species Human (GRCh38)
Location 18:58198437-58198459
Sequence CTAAAACAAAATTCGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158524301_1158524315 22 Left 1158524301 18:58198437-58198459 CCCTGGCCCGAATTTTGTTTTAG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1158524315 18:58198482-58198504 CTGGTGGCAAAAGGATCCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 160
1158524301_1158524311 6 Left 1158524301 18:58198437-58198459 CCCTGGCCCGAATTTTGTTTTAG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1158524311 18:58198466-58198488 GGGCCTATTTTAATTGCTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 109
1158524301_1158524314 21 Left 1158524301 18:58198437-58198459 CCCTGGCCCGAATTTTGTTTTAG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1158524314 18:58198481-58198503 GCTGGTGGCAAAAGGATCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 163
1158524301_1158524310 3 Left 1158524301 18:58198437-58198459 CCCTGGCCCGAATTTTGTTTTAG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1158524310 18:58198463-58198485 ATGGGGCCTATTTTAATTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 89
1158524301_1158524313 13 Left 1158524301 18:58198437-58198459 CCCTGGCCCGAATTTTGTTTTAG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1158524313 18:58198473-58198495 TTTTAATTGCTGGTGGCAAAAGG 0: 1
1: 0
2: 2
3: 25
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158524301 Original CRISPR CTAAAACAAAATTCGGGCCA GGG (reversed) Intronic
902796552 1:18804197-18804219 CTAAAGCAAAATGGTGGCCAAGG - Intergenic
904179824 1:28658358-28658380 ATAAAAAAAAAATTGGGCCAGGG + Intergenic
905045105 1:34991473-34991495 TAAAAACAAAAATCAGGCCAGGG + Intronic
909311057 1:74149964-74149986 ATACAACTAAATTCTGGCCAAGG + Intronic
910658023 1:89638236-89638258 CTAAAACAAAAATCCATCCAAGG + Intronic
911316545 1:96362880-96362902 CAAAAACAAAATTCAGATCATGG - Intergenic
911868180 1:103055101-103055123 CAAAACCAAAATTCAAGCCAGGG + Intronic
913164915 1:116176314-116176336 CTAAAACAGAATTGAGGTCAGGG + Intergenic
914896263 1:151676599-151676621 CTAAAACAAAATTCCTGGCCGGG - Intronic
921628663 1:217406874-217406896 TAAAAACAAAATTCTGGCTATGG - Intergenic
924385174 1:243493127-243493149 CTCAAACAAAAGACAGGCCAGGG - Intronic
1062889918 10:1050461-1050483 CTAAAGCATACTTCTGGCCAAGG + Intronic
1065013676 10:21442178-21442200 CAAAAATAAAATTTAGGCCAGGG + Intergenic
1066228627 10:33410329-33410351 CTCAAGCAAAATTCTGGCCTTGG - Intergenic
1068801826 10:61149688-61149710 CGTAAAAAAAATTGGGGCCAGGG + Intergenic
1069315299 10:67091828-67091850 CTAGAACAAAATAGGGACCAAGG + Intronic
1071664667 10:87542823-87542845 CTAACACAAAATTGGTACCAAGG + Intronic
1074680605 10:115903339-115903361 CTAAAGCAAAGTCCAGGCCAGGG - Intronic
1075213825 10:120514836-120514858 CAAAAACAAAATTTGGGCTGAGG - Intronic
1079048910 11:17135625-17135647 CTCAGACAAAATTAGGTCCATGG + Intronic
1081372758 11:42324122-42324144 TTAAATCAAGATGCGGGCCAAGG - Intergenic
1082802140 11:57422992-57423014 CTAAACCAAAAATTGAGCCACGG + Intronic
1083179084 11:60972691-60972713 TGGAAACAGAATTCGGGCCAGGG + Intronic
1085131434 11:74042456-74042478 CTAAAACATAAATCTGGCCGGGG + Intronic
1087548282 11:99612819-99612841 CTAAGACAAAATTCTGGCCTTGG + Intronic
1088687539 11:112297729-112297751 CAATAACAAAATCCGGCCCACGG - Intergenic
1088823105 11:113473565-113473587 CTAGAACCAAATGAGGGCCAGGG - Intronic
1089951220 11:122529169-122529191 CTAATATAAATTTTGGGCCAGGG - Intergenic
1090005236 11:122996592-122996614 CCAAAATCAAATTAGGGCCAGGG - Intergenic
1092764815 12:11842970-11842992 CTAAAACAAGAGGCAGGCCAGGG + Intronic
1093546750 12:20357554-20357576 CCCAAACCAAATTCAGGCCATGG + Intergenic
1096092661 12:48913647-48913669 AGAAAAAAAAATTCCGGCCATGG - Intronic
1096209933 12:49757024-49757046 AAAATACAAAATTAGGGCCAGGG - Intronic
1097629471 12:62042526-62042548 CTAGAACAGAATTCAGGGCAAGG - Intronic
1098096445 12:66961654-66961676 CTTTAAAAAAATTGGGGCCAAGG - Intergenic
1102462954 12:113111525-113111547 CTAAAACAAGATATGGACCATGG + Intronic
1103190387 12:118996516-118996538 CAAAAAGAAAATTAAGGCCAAGG + Intronic
1103327598 12:120131771-120131793 TTAAAGCAAAATCCAGGCCAGGG - Intronic
1103384995 12:120525096-120525118 CAAAAACAAAAGTCCGGGCACGG - Intronic
1103438408 12:120944891-120944913 ACAAAACAAAACTCAGGCCAGGG + Intergenic
1104068169 12:125322573-125322595 CTAAAACTAAATTGTGGCAATGG + Intronic
1104581180 12:130011924-130011946 CTACCACAAAATTCCAGCCAAGG - Intergenic
1107153238 13:37137044-37137066 AGAAAACAAAATTCTGGTCAAGG - Intergenic
1111799953 13:92969243-92969265 TAAAAACAAAATTTGGGCCCTGG - Intergenic
1115107895 14:29782836-29782858 GTAAAAAACAATTTGGGCCAGGG - Intronic
1116507088 14:45696775-45696797 CAAAAACAAAATTCTCCCCATGG - Intergenic
1117674432 14:58141357-58141379 CAAAACCAAAATTCAGGACAAGG + Intronic
1118400226 14:65372954-65372976 CTAGAACAGAATTCGGGGTAGGG + Intergenic
1121359076 14:93239416-93239438 ATAAAATAAAATTTAGGCCATGG - Exonic
1121534100 14:94679382-94679404 CTAAAACACAAATCTGACCATGG - Intergenic
1124171376 15:27376621-27376643 CCAACATAAAGTTCGGGCCATGG - Intronic
1125207657 15:37173002-37173024 TTAAAAAAAAATTCAGGCCATGG - Intergenic
1126102386 15:45127582-45127604 TGAAAACAAAATTAGGGTCAGGG - Intronic
1131300260 15:91193424-91193446 CAAAAACAAAATCAGAGCCAGGG + Intronic
1134513675 16:14869350-14869372 CTAAAACTGGATTCTGGCCATGG - Intronic
1134701316 16:16267846-16267868 CTAAAACTGGATTCTGGCCATGG - Intronic
1136129177 16:28208743-28208765 CAATAACAAAATTCTGTCCAAGG + Intronic
1136332981 16:29594393-29594415 CCAAAACAAAACTCCAGCCAAGG - Intergenic
1136447677 16:30334481-30334503 CCAAAACAAAACTCCAGCCAAGG - Intergenic
1138269752 16:55686773-55686795 CTCAAACAAAATGCAGACCAGGG + Intronic
1138734576 16:59235613-59235635 CCAAAACAAAATTGGGGGAAGGG - Intergenic
1139924354 16:70478042-70478064 CTAAAACAAAACTCAGGCCTTGG + Intronic
1140250177 16:73288267-73288289 CTCAAATAAAAATCCGGCCAGGG + Intergenic
1141056395 16:80819165-80819187 TTAAAACACATTTCCGGCCAGGG - Intergenic
1156657223 18:39303048-39303070 CTAAAAAAAAATTAGGGGTAAGG + Intergenic
1158524301 18:58198437-58198459 CTAAAACAAAATTCGGGCCAGGG - Intronic
1163830811 19:19546422-19546444 CAAAAACAAAGCTCGGGGCAGGG - Exonic
1165681642 19:37781641-37781663 TTAAAACAGACCTCGGGCCATGG + Intronic
1166030560 19:40122911-40122933 CCAAAACAAATTTTGGACCAAGG + Intergenic
931255154 2:60565174-60565196 CTAAAACAATATATGTGCCATGG + Intergenic
933426881 2:82125203-82125225 CTAAAGCAGAATTTGAGCCAAGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
937502428 2:122494215-122494237 CTAAAACACCATGCGGGCCCTGG - Intergenic
938574983 2:132595395-132595417 AAAAAACAAAATTAGGCCCATGG - Intronic
941409581 2:165137244-165137266 CTAAAACAAACTTGGGGCAAGGG - Intronic
942893997 2:181028721-181028743 ATAAAACAAAATTGGGGGCAGGG - Intronic
944466832 2:200010185-200010207 ATAAAACAAAAGTAGGGCTAAGG - Intergenic
944978043 2:205080103-205080125 CTGAAACAAAATAGGAGCCAGGG - Intronic
945933734 2:215882316-215882338 CTACAACAAAATTTGGGGAAGGG - Intergenic
1170314778 20:15030909-15030931 CCCAAGCAAAATTCGGGCAAAGG - Intronic
1171105081 20:22425677-22425699 CAAAAACAAAACTAGGACCATGG + Intergenic
1172768896 20:37365876-37365898 AAAAAAAAAAATTCTGGCCAGGG - Intronic
1173685076 20:44917665-44917687 CAAAATCAAAATTCTGGGCAGGG - Intronic
1177037254 21:16059919-16059941 CTCAAGCAAAATTTGGGCAAAGG - Intergenic
1178993691 21:37377407-37377429 GTAAAAAAAAATGCGGGGCACGG - Intronic
1183444825 22:37846598-37846620 TTAAAAAAAAATTGGGGCCCAGG - Intronic
949218406 3:1600238-1600260 CTCAAGCAAAACTCGGGCAAAGG - Intergenic
951373795 3:21888337-21888359 ATAAAACAAAATAGGGGCCAAGG + Intronic
953931215 3:47006745-47006767 CTAAAAAAAAAGTCAGGCCTGGG - Intronic
955846556 3:63169333-63169355 ATAAACTAAAATTCGGGCCTTGG + Intergenic
957347918 3:78985501-78985523 CTAGAACAACACTGGGGCCAGGG - Intronic
957427176 3:80052628-80052650 CTCAAGCAAAACTCGGGCAAAGG + Intergenic
962488592 3:135868595-135868617 CTAAGACAAAATTGGAACCAAGG - Intergenic
962637082 3:137342477-137342499 CTAAAACAACATTCGTGCTTGGG + Intergenic
966630190 3:182064335-182064357 CTAAAAAAAAACTCAGGCCAAGG - Intergenic
967085738 3:186093580-186093602 CAAAAACTAAATTCTGCCCATGG + Intronic
967415138 3:189208448-189208470 CTCATAAAAAATTGGGGCCAGGG + Intronic
970562219 4:17293368-17293390 ATAAAACCAAATTATGGCCATGG - Intergenic
970790485 4:19852551-19852573 CTAATCCAAAATACTGGCCATGG - Intergenic
974743719 4:66042321-66042343 CTCAAACAAAAAATGGGCCATGG + Intergenic
975696996 4:77023225-77023247 CAAAAGCAAAACTCAGGCCAGGG - Intronic
977284394 4:95084480-95084502 CTAAAACAAAATTTGAGAAAAGG - Intronic
984044120 4:174776262-174776284 CTAAAGCAAAGCTCTGGCCAGGG + Intronic
984482075 4:180318211-180318233 CTAAGACTAAATCCTGGCCATGG - Intergenic
988668374 5:33354832-33354854 CAAAAACAGAATTCTGCCCAGGG + Intergenic
989601209 5:43202342-43202364 CTAAAACAAATTTGGGGGCTAGG - Intronic
990080945 5:51912839-51912861 GTAAAAGAAAATTTGGGTCAAGG + Intergenic
992138082 5:73767979-73768001 CCAACACAGAACTCGGGCCATGG + Intronic
994520603 5:100829450-100829472 CTAAAATAGAATTCAGGCAAAGG - Intronic
999577806 5:152999165-152999187 CAAGAACAAAATTTGGGCCTTGG + Intergenic
1002199405 5:177519105-177519127 CGAAAACTAAATTTGGGGCATGG + Intergenic
1002617118 5:180462855-180462877 CTCAAAAAAAATCCTGGCCAGGG - Intergenic
1003848790 6:10200917-10200939 TTAAAACAAAATTCATGCCCTGG + Intronic
1007115873 6:39343014-39343036 CTAAGACAAAATGCAGGCCTGGG + Intronic
1008931363 6:56943819-56943841 CTAAAATAAAATACGGGGCCAGG + Intronic
1011453695 6:87524082-87524104 CTAATATAAAATTCTGGCCTGGG + Intronic
1011461970 6:87614230-87614252 CCAACACAAAGTTCGGGCCACGG - Intronic
1014588513 6:123231796-123231818 TTAAAACAAAATTAGGGTCCGGG + Intronic
1017200980 6:151754914-151754936 CTAAAACCAAATTCTGGGCTGGG + Intronic
1018537296 6:164835078-164835100 CTAAAACTAAAGTCGCTCCACGG - Intergenic
1020492240 7:8801874-8801896 CTAAAACAAATTTTGGGTGAGGG - Intergenic
1028052950 7:86207813-86207835 CTCAAACAAAACTCAGGCAAAGG - Intergenic
1028739747 7:94260089-94260111 CAAAAACAAAATTTGAACCAAGG + Intergenic
1030910265 7:115239253-115239275 CAAACACAATATTCAGGCCAAGG + Intergenic
1031290038 7:119922775-119922797 TTAAGACAAAATTTGGCCCAAGG + Intergenic
1031716953 7:125120975-125120997 CAAAAACAAAATTTGGGCTTTGG + Intergenic
1031797702 7:126197226-126197248 CTAAAATTAAATTAGGGTCATGG + Intergenic
1032813023 7:135442238-135442260 CTAAATGAAAATTTGGGCAAGGG - Intronic
1034171972 7:149069610-149069632 AAAAAAAAAAATTTGGGCCAGGG - Intergenic
1040455667 8:47594838-47594860 CTAAAAAAAAATACTGGGCATGG + Intronic
1041350357 8:56942167-56942189 CTTAAAAACAATACGGGCCAGGG + Intergenic
1042680840 8:71381285-71381307 AAAAAAGAAAATTAGGGCCATGG + Intergenic
1043059352 8:75480481-75480503 GTAAAACAAAATTCAGGCGGAGG + Intronic
1043632177 8:82349297-82349319 TTAAAACTAAATTTGGGCCTGGG - Intergenic
1044085155 8:87934967-87934989 CTATAACAAAATTCCGGGCCAGG + Intergenic
1044656950 8:94558190-94558212 CTATATCAAAATTCCGGCCCGGG + Intergenic
1045791134 8:105985874-105985896 CTAAAGCAAAATGCTGTCCAAGG - Intergenic
1052623657 9:30945151-30945173 CTGAAGCAAAATTCCGGCAAAGG + Intergenic
1055236276 9:74127252-74127274 TTAAAATAAAGTTCGTGCCAGGG + Intergenic
1055454660 9:76460871-76460893 CTAGTACAAACTTGGGGCCAAGG - Intronic
1055543445 9:77340644-77340666 CTAAAACAAAATTGGAGTAAGGG - Intronic
1057413060 9:94835383-94835405 ATAAAAGAAAATACTGGCCAAGG - Intronic
1057522260 9:95769418-95769440 CTCTAACAACATTTGGGCCAGGG + Intergenic
1057624033 9:96661606-96661628 AAAATACAAAATTAGGGCCAGGG - Intergenic
1059954400 9:119500626-119500648 CTAAAATAAAAATTGGGTCATGG + Intronic
1185529350 X:805262-805284 CTAAAACGAAATTAGAGACAGGG - Intergenic
1186425474 X:9461759-9461781 CTAAAAAAAAATTAGAGACAAGG + Intergenic
1187474992 X:19602727-19602749 CTAAATAAAAATTAGGGCCAGGG + Intronic
1189754832 X:44260421-44260443 GGAAAACAAAATTTGGGCCCAGG + Intronic
1196287421 X:113898543-113898565 CTGAGAAAAAATTCGGGACATGG + Intergenic
1196334581 X:114516795-114516817 CTGAAACATAAATAGGGCCAAGG - Intergenic
1196675150 X:118412387-118412409 CTAAAACAAAAATCTGAACATGG - Intronic
1196732591 X:118955962-118955984 CTAAACCAAAATCTGGGCCTAGG + Intergenic
1196942299 X:120789098-120789120 CTAAAACAAAAATCAAACCATGG - Intergenic
1198285204 X:135182938-135182960 TGAAAACAAAATTCAGGTCAGGG + Intergenic
1199498626 X:148484097-148484119 ATAAAAAAAAATGTGGGCCAAGG + Intergenic