ID: 1158525916

View in Genome Browser
Species Human (GRCh38)
Location 18:58213624-58213646
Sequence CTCATCACTGGTGAGTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158525916_1158525919 11 Left 1158525916 18:58213624-58213646 CCAAGTCACTCACCAGTGATGAG 0: 1
1: 0
2: 3
3: 15
4: 157
Right 1158525919 18:58213658-58213680 TCCCCATTTTTTTCCTATGAAGG 0: 1
1: 0
2: 2
3: 28
4: 287
1158525916_1158525924 28 Left 1158525916 18:58213624-58213646 CCAAGTCACTCACCAGTGATGAG 0: 1
1: 0
2: 3
3: 15
4: 157
Right 1158525924 18:58213675-58213697 TGAAGGAAGCTGCAATGCTGTGG 0: 1
1: 0
2: 2
3: 33
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158525916 Original CRISPR CTCATCACTGGTGAGTGACT TGG (reversed) Intronic
901314220 1:8294868-8294890 ATCATCACTGGTTTGTGACCTGG - Intergenic
901835882 1:11923787-11923809 CTCAGCACTGGTGACTGATCTGG - Intronic
903793118 1:25907680-25907702 CACATCCCTGGTGACTAACTAGG - Intergenic
905511806 1:38527691-38527713 TTCATCAGAGGTGAGTCACTAGG - Intergenic
905808804 1:40896927-40896949 CTCAGCACTGGGAAATGACTGGG - Intergenic
906935407 1:50210064-50210086 CTCTCCACTGCTGAGTCACTGGG - Intergenic
909486254 1:76177855-76177877 TTCATCACTCTTGAGTGACGGGG + Intronic
914255410 1:145958073-145958095 CCCATCACTGGTGATTGGCATGG - Intergenic
917335572 1:173921351-173921373 CCCATCACTGGTGATTAACTTGG + Intergenic
920272404 1:204775756-204775778 CTCAACAGTGGTGATTGACAGGG + Intergenic
922193750 1:223341734-223341756 CTCACCACTGGTCACTAACTGGG - Intronic
924076349 1:240341820-240341842 CTCCACACTAGTGAATGACTTGG + Intronic
1063138571 10:3237664-3237686 GTCATCACTGGTTTGTGAATAGG - Intergenic
1063252028 10:4284194-4284216 CCCATCAATGGTGTGTCACTGGG - Intergenic
1064486101 10:15792199-15792221 CTCAGCTCTGGTGTGTGACTTGG - Intronic
1065774683 10:29108532-29108554 CTCACCAATGGAGAGTGAGTGGG - Intergenic
1072097366 10:92195174-92195196 CTCATCACTGTAGTTTGACTTGG - Intronic
1072216371 10:93290796-93290818 CTCATCACTGGTCAGGCACAAGG + Intergenic
1073452037 10:103615851-103615873 CTCATGGCTGGTGGGTGATTGGG + Intronic
1074031015 10:109688167-109688189 TTCATGACTGGTTAGGGACTTGG - Intergenic
1074425806 10:113350207-113350229 AACATCACTGGTGAGTTTCTAGG + Intergenic
1075236074 10:120730140-120730162 CTCGTCACTATTGACTGACTTGG - Intergenic
1075452663 10:122562911-122562933 GACAGCACTGGTGAGTGGCTGGG + Intronic
1076088496 10:127657659-127657681 TTGAGCACAGGTGAGTGACTAGG + Intergenic
1079652968 11:22953362-22953384 CTCAACACAGGGCAGTGACTGGG + Intergenic
1079922067 11:26445503-26445525 CTCATCACTTTTGTGTGTCTCGG + Intronic
1080684989 11:34507810-34507832 CACACCACTGGTAAGTGTCTTGG + Intronic
1082025149 11:47565977-47565999 CTCTTCACAGGTGAGGGACCGGG + Exonic
1083167628 11:60900841-60900863 ATCCTCACTGGTGAGAGTCTGGG - Exonic
1083422198 11:62560269-62560291 CTCATCACTGGTAAGAGAGTGGG - Exonic
1085045554 11:73350942-73350964 CTGAGCATTGGTGAGTGAATGGG + Intronic
1088628388 11:111749995-111750017 CTCTTCACTGGTGATTGTCATGG - Intronic
1088863158 11:113821071-113821093 GTTGTCACTGGTGAGGGACTTGG + Intronic
1089588424 11:119524476-119524498 CTCACCACTGGTGTATGGCTTGG - Intergenic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1090256744 11:125289801-125289823 CTCACCACTGGCGTGTCACTCGG + Intronic
1091909874 12:4220873-4220895 GTCATCAGTGGTGAGTGGCTGGG - Intergenic
1093416037 12:18922312-18922334 CACATCACCGCTGAGTAACTGGG + Intergenic
1099942614 12:89206690-89206712 TTCATCACTGGTTATTTACTTGG + Intergenic
1100778001 12:97993402-97993424 CTCATCAAAGTTAAGTGACTTGG + Intergenic
1105532872 13:21236117-21236139 CTCATGACTGGAGAGGGTCTAGG - Intergenic
1108274890 13:48797590-48797612 TTCATCATTGCTGAGTGATTGGG - Intergenic
1108474076 13:50796376-50796398 CTCCTCACCTGTGAGTCACTTGG - Intronic
1111788525 13:92822493-92822515 CTCATTACTGGTAAATGACCAGG + Intronic
1112159796 13:96855344-96855366 CACACCACTGTTGAGTGACAAGG + Intergenic
1118071654 14:62252254-62252276 CTCAGAACTGGGCAGTGACTTGG - Intergenic
1121019306 14:90569377-90569399 CTCATCCCTGGATGGTGACTTGG - Intronic
1121402323 14:93690844-93690866 CTCATGACTGGTGCCTGCCTTGG - Intronic
1121795149 14:96728381-96728403 CTCATGACTTGGGAGTGACTTGG + Intergenic
1121993568 14:98584393-98584415 CTCACCTCTGGTGAATGACTTGG - Intergenic
1122314052 14:100815321-100815343 GTCCTCCCTGGTGAGTGATTGGG - Intergenic
1202921234 14_KI270723v1_random:31891-31913 CTAATCCCTGGTGAGTGACTGGG - Intergenic
1202923674 14_KI270724v1_random:5689-5711 CTAATCCCCGGTGAGTGACTGGG + Intergenic
1123401726 15:19994030-19994052 GTCACCACTGGTGAGTGAACAGG + Intergenic
1123511069 15:21000691-21000713 GTCACCACTGGTGAGTGAACAGG + Intergenic
1124503586 15:30252280-30252302 CTTATAGCTGGTGAGAGACTAGG - Intergenic
1124717964 15:32084412-32084434 TTCAGCACTGGGGACTGACTGGG + Intronic
1124739969 15:32286358-32286380 CTTATAGCTGGTGAGAGACTAGG + Intergenic
1126164259 15:45640780-45640802 TTCATCCCTGTTGTGTGACTGGG + Intronic
1126543794 15:49850675-49850697 CTCAGCACTGTTGATTGAATAGG - Intergenic
1129714008 15:77836512-77836534 CTCCTCACTGCTGAGGGGCTTGG - Intergenic
1131552440 15:93369024-93369046 CCCATCACTAGTGAGTGGATTGG + Intergenic
1131635281 15:94226829-94226851 TTCATCACTTGGGACTGACTGGG + Intergenic
1133118601 16:3592545-3592567 GTCATCACTGGTCATGGACTTGG + Intronic
1134053904 16:11157237-11157259 CACATCACTGATCACTGACTAGG - Intronic
1134916899 16:18080220-18080242 CTCACGGCTGGTGAATGACTGGG + Intergenic
1139511684 16:67431504-67431526 CTCATCACCGGTGAGTGCGCGGG + Exonic
1140986880 16:80166290-80166312 ATCATCACTTGTGATTGTCTTGG - Intergenic
1141021050 16:80496895-80496917 GTGACCACTGGTGAGTGTCTGGG + Intergenic
1141665996 16:85465399-85465421 TTCATTACTGCTGTGTGACTTGG + Intergenic
1142314436 16:89334687-89334709 CTCATCCCTGGGGTGTGCCTGGG - Intronic
1144733291 17:17540812-17540834 CTCATCACTGGCGAGTGAATGGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1146055969 17:29581400-29581422 CCCAGCACTAGTGAGTGACTTGG - Intronic
1146605346 17:34252846-34252868 GTCATCTCTGGAAAGTGACTTGG - Intergenic
1147812952 17:43186384-43186406 CTCTTCACTGGTGAGAGTCTTGG + Exonic
1147941898 17:44054682-44054704 CCCATCACTGCTGAGTGGCAGGG - Intronic
1147944837 17:44075078-44075100 CTAATAACTGGTGAGCAACTGGG + Exonic
1150197556 17:63316561-63316583 CTCATGAATGGGGAGTGTCTTGG - Intronic
1151174559 17:72276448-72276470 CACATCAATGGTTAGTAACTAGG + Intergenic
1154173027 18:12064181-12064203 CCTGTGACTGGTGAGTGACTCGG - Intergenic
1155491434 18:26405311-26405333 CTCATGACTGGTGAGAGGTTTGG + Intergenic
1157305892 18:46517306-46517328 CTAATCACTAATGAGTGATTAGG + Intronic
1157999577 18:52600897-52600919 CTCATCCCTAGTGAGTAAATTGG + Intronic
1158525916 18:58213624-58213646 CTCATCACTGGTGAGTGACTTGG - Intronic
1158716096 18:59881143-59881165 TTCATCAGTGTTGTGTGACTTGG - Intergenic
1160711960 19:556186-556208 CCCAGCCCCGGTGAGTGACTGGG + Intergenic
1163215125 19:15871025-15871047 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163228294 19:15980174-15980196 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1168281235 19:55306441-55306463 CTCATCTCGGGTGAGTCTCTTGG + Exonic
926299495 2:11592294-11592316 CTTATAATTGGTGAGTGGCTTGG + Intronic
930107643 2:47652672-47652694 CTCAGGAAGGGTGAGTGACTTGG - Intergenic
933724056 2:85416441-85416463 CTCATCACGGGGGACTGACAGGG + Intronic
938146795 2:128841282-128841304 TACATCCCTGGTGAGTGACCCGG - Intergenic
940128088 2:150350168-150350190 ATCATTACTGGTGACTGACGGGG + Intergenic
942609225 2:177725154-177725176 CTCATCTCTGGAATGTGACTCGG - Intronic
944209946 2:197196897-197196919 CTCTCCACAGGTGAGGGACTAGG + Intronic
946183713 2:217964935-217964957 CTCCTGGCTGATGAGTGACTTGG - Intronic
948759620 2:240182680-240182702 CACAGCACTGCTGAGTGTCTGGG + Intergenic
1171347810 20:24479216-24479238 CCCAGCCCTGGAGAGTGACTTGG + Intronic
1172078214 20:32316045-32316067 TCCATCACTGGTGAGGGACTGGG - Intronic
1174132202 20:48353143-48353165 CTCATCAGTGGTGAGACCCTTGG - Intergenic
1174641289 20:52046463-52046485 CTCCTCACTGGAGGGTGACTAGG + Intergenic
1174795762 20:53521542-53521564 CTCATATCTGGTGAATGAATGGG - Intergenic
1175805957 20:61829656-61829678 CTCACCACTGGGGACGGACTTGG + Intronic
1175834361 20:61984142-61984164 CTCATCACTGAGGAGCGGCTCGG + Intronic
1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG + Intergenic
1177056916 21:16317792-16317814 TTCATTCATGGTGAGTGACTTGG + Intergenic
1178104019 21:29298944-29298966 CTCAGCTCTGGTGAGTGGCTCGG + Intronic
1179294830 21:40052467-40052489 CTCATCACTGGTGAGGGGGCTGG - Intronic
1179754388 21:43486493-43486515 CTCATGTCTGCTGGGTGACTTGG - Intergenic
1182510596 22:30817344-30817366 CTCATCACTAATGAGGGGCTGGG - Intronic
1184872729 22:47251265-47251287 GTGACCTCTGGTGAGTGACTTGG + Intergenic
951491051 3:23270979-23271001 CTTCTAACTTGTGAGTGACTTGG + Intronic
952407208 3:33015302-33015324 CTCATAACAGGTGAGTGACTCGG - Intronic
955145480 3:56314147-56314169 CCCATAACTAGTGAGTGACCAGG - Intronic
955711184 3:61780647-61780669 CTCATCAGTAGGGACTGACTAGG - Intronic
957979472 3:87490157-87490179 CTCATTACTGTTGTGTCACTTGG + Intergenic
962737614 3:138339803-138339825 CTTATCACTGGGGAGTGGATAGG - Intergenic
963736243 3:149020457-149020479 CCCATGGCTGGTGAGTGACAAGG - Intronic
964052851 3:152417934-152417956 CTCATAAATTGTGAGTGACGAGG + Intronic
966553449 3:181230796-181230818 CTCATCAATGGTGTGGGAATTGG - Intergenic
969675142 4:8610392-8610414 CCCATCACTGGTCAGTCTCTAGG - Intronic
971529207 4:27663036-27663058 CTCAACACTGCTTATTGACTAGG - Intergenic
978560891 4:110032426-110032448 CACATCACTGGTGGGAGACAAGG - Intergenic
979103209 4:116649671-116649693 TTCATCACTCGTGAGAGACAAGG + Intergenic
983523512 4:168736003-168736025 CACATCACTGGAGAGTTTCTGGG - Intronic
983577780 4:169276895-169276917 CTCATCCCTGGAGAGTTAGTAGG + Intergenic
985842363 5:2317791-2317813 CTCACCACTGGGGAGTAACCAGG - Intergenic
988776121 5:34479392-34479414 CTTCACACTGGTGAGTGTCTAGG + Intergenic
992507110 5:77397920-77397942 CTCATCTCTGGTTAGTGTGTGGG - Intronic
996172793 5:120315338-120315360 CTCATTACTGGTTAGTGAATGGG - Intergenic
997471610 5:134120432-134120454 CTCATCACAGCCGAGTGCCTGGG + Intronic
997646180 5:135483494-135483516 GACATCCCTGGTCAGTGACTTGG - Intergenic
998556996 5:143135199-143135221 CTCATCAGCAGTGAGTGGCTTGG + Intronic
999534061 5:152498091-152498113 CTCATAAATGATGATTGACTGGG + Intergenic
1003389388 6:5700095-5700117 CTCATGACTGGAGAGGGCCTAGG + Intronic
1007615238 6:43175958-43175980 CTCATGCCTGGTGAGTCACGAGG + Exonic
1008033750 6:46724738-46724760 CTCTTCTCTGTTCAGTGACTAGG - Intronic
1008504985 6:52221112-52221134 CTCATCACTGATAAGTGAAATGG - Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1013753915 6:113438731-113438753 CTGATCACTAGTGTGTAACTTGG - Intergenic
1016316997 6:142801149-142801171 CTCATACCTGGTGAGTCCCTGGG - Intronic
1017135997 6:151147914-151147936 CCCATGACTGCTGAGTGCCTGGG - Intergenic
1018586027 6:165360287-165360309 CTCCTCACGGGTCAGTGGCTGGG - Intronic
1018747123 6:166771244-166771266 CTCGTCACTGATGCGTGGCTTGG - Intronic
1019357848 7:590289-590311 CTCCTCACCGGTGCGTGCCTTGG - Intronic
1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG + Intronic
1021219897 7:17963493-17963515 ATGATCACATGTGAGTGACTTGG - Intergenic
1021358165 7:19679764-19679786 CTCATTACTGGTAAGTGGCAAGG - Intergenic
1023858993 7:44205852-44205874 CTCCACTCTGGTGGGTGACTGGG - Intronic
1026597126 7:71742784-71742806 TTCATCACTGATGAGCAACTAGG + Intergenic
1027625382 7:80538226-80538248 TTCTTCACTTGTGAGTTACTTGG - Intronic
1029303137 7:99600061-99600083 CTCATCACTGGAGAGTGGAGGGG + Intronic
1031454257 7:121959792-121959814 GCTATCAGTGGTGAGTGACTTGG - Intronic
1036282702 8:7415348-7415370 CTGATCTCTCCTGAGTGACTGGG + Intronic
1036338772 8:7896201-7896223 CTGATCTCTCCTGAGTGACTGGG - Intronic
1037764579 8:21764531-21764553 CTGGTCACTGGTGGGTGACAAGG - Intronic
1038018812 8:23536106-23536128 CCCCTCACTCTTGAGTGACTCGG + Intronic
1048534413 8:135279164-135279186 TTTATCACAGGTGTGTGACTTGG + Intergenic
1048622447 8:136148706-136148728 ATCAGCATTGGTGAATGACTTGG - Intergenic
1052325172 9:27209854-27209876 GTAATTACTGGTGAGTGAGTAGG + Intronic
1054872443 9:70060654-70060676 CTCATGACTGGGCAGTGTCTTGG - Intronic
1054960438 9:70962270-70962292 CTCATCACTGGAGAGCTTCTTGG - Intronic
1054986644 9:71269541-71269563 CTCATCACTGGCCAGTGAGCTGG + Intronic
1060405266 9:123369902-123369924 CTCATGTCTGGTGAGTGTCCAGG - Intronic
1061424132 9:130488696-130488718 GACAGCACTGGTGAGGGACTCGG + Intronic
1186124966 X:6403228-6403250 CTCTTCACAGGAGAGTGACAAGG + Intergenic
1189833254 X:44996385-44996407 CTCATAACTAGTAAGTGACAAGG + Intronic
1189833258 X:44996454-44996476 CTCATAACTAGTAAGTGACAAGG - Intronic
1192988847 X:76428670-76428692 CTCATCACGGGTGGGTGGCACGG - Exonic
1194522301 X:94934228-94934250 CTAATCAGTGAGGAGTGACTAGG - Intergenic
1195420677 X:104671997-104672019 CACCTCAGTGGTCAGTGACTTGG + Intronic
1195848268 X:109253349-109253371 ATCAGCACAGTTGAGTGACTGGG - Intergenic
1195875570 X:109537012-109537034 CACGTCTCTGGTGAGTGCCTGGG + Exonic
1197475045 X:126911961-126911983 CTCATTACGGGTTAGTGAATGGG - Intergenic