ID: 1158527011

View in Genome Browser
Species Human (GRCh38)
Location 18:58224001-58224023
Sequence GTCCTCCCTGTGGCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158527011_1158527020 22 Left 1158527011 18:58224001-58224023 CCCACAGGGGCCACAGGGAGGAC No data
Right 1158527020 18:58224046-58224068 CCCCTGCCCTTCAGACTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158527011 Original CRISPR GTCCTCCCTGTGGCCCCTGT GGG (reversed) Intronic