ID: 1158527997

View in Genome Browser
Species Human (GRCh38)
Location 18:58232557-58232579
Sequence CCGGTTACACAGATCAATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158527997_1158528002 12 Left 1158527997 18:58232557-58232579 CCGTAATTGATCTGTGTAACCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1158528002 18:58232592-58232614 TCCTATGGCACCCTTGTGTCGGG 0: 1
1: 0
2: 1
3: 8
4: 79
1158527997_1158528004 19 Left 1158527997 18:58232557-58232579 CCGTAATTGATCTGTGTAACCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1158528004 18:58232599-58232621 GCACCCTTGTGTCGGGATATAGG 0: 1
1: 0
2: 0
3: 5
4: 29
1158527997_1158528000 -3 Left 1158527997 18:58232557-58232579 CCGTAATTGATCTGTGTAACCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1158528000 18:58232577-58232599 CGGAGAAAATACATATCCTATGG 0: 1
1: 0
2: 0
3: 9
4: 103
1158527997_1158528005 20 Left 1158527997 18:58232557-58232579 CCGTAATTGATCTGTGTAACCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1158528005 18:58232600-58232622 CACCCTTGTGTCGGGATATAGGG 0: 1
1: 0
2: 0
3: 4
4: 37
1158527997_1158528006 21 Left 1158527997 18:58232557-58232579 CCGTAATTGATCTGTGTAACCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1158528006 18:58232601-58232623 ACCCTTGTGTCGGGATATAGGGG 0: 1
1: 0
2: 0
3: 5
4: 30
1158527997_1158528008 22 Left 1158527997 18:58232557-58232579 CCGTAATTGATCTGTGTAACCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1158528008 18:58232602-58232624 CCCTTGTGTCGGGATATAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1158527997_1158528001 11 Left 1158527997 18:58232557-58232579 CCGTAATTGATCTGTGTAACCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1158528001 18:58232591-58232613 ATCCTATGGCACCCTTGTGTCGG 0: 1
1: 0
2: 2
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158527997 Original CRISPR CCGGTTACACAGATCAATTA CGG (reversed) Intronic
908948620 1:69530683-69530705 CTGGTTACATAGAACAATTCAGG + Intergenic
922843605 1:228665112-228665134 CCTGGTTCACATATCAATTAAGG + Intergenic
1065555895 10:26915357-26915379 CTGGTAAGACAGATCATTTAGGG + Intergenic
1069055799 10:63843680-63843702 CAGGTTAGAAAGATGAATTATGG - Intergenic
1069247273 10:66221406-66221428 ACGGTAACTCAGATCAATTCTGG + Intronic
1095769187 12:45932920-45932942 CTTGTTAAACAGATAAATTAAGG + Intronic
1096838716 12:54368433-54368455 CCTGTTCCACAGACCATTTAGGG + Intergenic
1105459906 13:20574671-20574693 CAGGTTACAAAAATGAATTAAGG + Intronic
1107285547 13:38786434-38786456 CTTATTACACTGATCAATTAAGG - Intronic
1108373099 13:49790515-49790537 CTTGTTACACAGATTAAATAAGG + Intronic
1113369894 13:109714218-109714240 CAGCTTACACTGATCAATTTAGG + Intergenic
1115327799 14:32161737-32161759 CAGGTCACACAGACCAATTTTGG - Intergenic
1136654271 16:31700617-31700639 CAGGGTACACAGATCAAGCAGGG - Intergenic
1155329244 18:24698117-24698139 ACGGTTACACAGCTGAAATAAGG + Intergenic
1158527997 18:58232557-58232579 CCGGTTACACAGATCAATTACGG - Intronic
1159030413 18:63225136-63225158 CCAGGTACAAAGATCAATTAAGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
938629500 2:133150843-133150865 CCATTAACACAGATAAATTATGG + Intronic
1177333811 21:19697755-19697777 CCTGGTTCACAGATGAATTATGG - Intergenic
1181158434 22:20940660-20940682 CAGATGACACAGAGCAATTATGG - Intronic
957611727 3:82475138-82475160 CCATTTTCACAGATCATTTATGG + Intergenic
965207636 3:165742668-165742690 CTGCTTACACAGATCAGGTAAGG - Intergenic
973154983 4:46939682-46939704 CTGTTTACAAAGATCACTTAGGG - Intronic
976311545 4:83618195-83618217 CTGATTACACAAGTCAATTAGGG + Intergenic
980659491 4:135839207-135839229 CTGTTTACACAGGTCAAGTAAGG - Intergenic
982420269 4:155187257-155187279 CTGTTCACACAAATCAATTAAGG - Intergenic
983645530 4:169987156-169987178 TGGGTTACACAAATCAATTGTGG - Exonic
986305737 5:6514357-6514379 CCGGTTACATACAGCAATTTAGG + Intergenic
997242623 5:132318953-132318975 CTGATTACACAGATCTTTTATGG - Intronic
1011574612 6:88782095-88782117 CCCTTTACACAGAATAATTAAGG + Intronic
1016057195 6:139590912-139590934 CCTGTTAAACAGATCAAATAAGG + Intergenic
1016087348 6:139930072-139930094 CCGGTTAAACACATCAGTCAAGG + Intergenic
1022181030 7:27920429-27920451 CTGCTTACACAGTTCAGTTATGG - Intronic
1022628695 7:32065001-32065023 CCTGTTACCCAGACCAATTCAGG + Intronic
1036741586 8:11366875-11366897 CCAGTTCCACAGATTAATCATGG + Intergenic
1042990966 8:74639362-74639384 CCTGTTACAAAGATCATATAAGG - Intronic
1044059623 8:87619388-87619410 CCTATTACACATATCAATAAAGG + Intergenic
1049486828 8:142869510-142869532 CTGCTTATACAGATCAAATAAGG + Intronic
1053319299 9:37080694-37080716 CAGATTACACAGTTGAATTAGGG + Intergenic
1056467863 9:86876701-86876723 CTGGTTCCAGAGAACAATTACGG - Intergenic
1187404638 X:18992164-18992186 TCTGTGACACAGATCAAATAGGG + Intronic
1195268388 X:103206435-103206457 TCTGTTACACAGAGCAATTGTGG + Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1198592998 X:138204930-138204952 TCAGTTACACAGATAAACTAAGG + Intergenic