ID: 1158530446

View in Genome Browser
Species Human (GRCh38)
Location 18:58255935-58255957
Sequence GCCACGGACGGGGCCACGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158530432_1158530446 23 Left 1158530432 18:58255889-58255911 CCGCCCCACGTGCAGCTCCTCCG 0: 1
1: 0
2: 1
3: 25
4: 233
Right 1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG 0: 1
1: 0
2: 0
3: 7
4: 126
1158530436_1158530446 6 Left 1158530436 18:58255906-58255928 CCTCCGTGCAGATCTCCCTGCAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG 0: 1
1: 0
2: 0
3: 7
4: 126
1158530433_1158530446 20 Left 1158530433 18:58255892-58255914 CCCCACGTGCAGCTCCTCCGTGC 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG 0: 1
1: 0
2: 0
3: 7
4: 126
1158530437_1158530446 3 Left 1158530437 18:58255909-58255931 CCGTGCAGATCTCCCTGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 224
Right 1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG 0: 1
1: 0
2: 0
3: 7
4: 126
1158530435_1158530446 18 Left 1158530435 18:58255894-58255916 CCACGTGCAGCTCCTCCGTGCAG 0: 1
1: 0
2: 1
3: 13
4: 107
Right 1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG 0: 1
1: 0
2: 0
3: 7
4: 126
1158530434_1158530446 19 Left 1158530434 18:58255893-58255915 CCCACGTGCAGCTCCTCCGTGCA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG 0: 1
1: 0
2: 0
3: 7
4: 126
1158530440_1158530446 -9 Left 1158530440 18:58255921-58255943 CCCTGCAGCGCAAGGCCACGGAC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG 0: 1
1: 0
2: 0
3: 7
4: 126
1158530431_1158530446 24 Left 1158530431 18:58255888-58255910 CCCGCCCCACGTGCAGCTCCTCC 0: 1
1: 0
2: 7
3: 62
4: 573
Right 1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG 0: 1
1: 0
2: 0
3: 7
4: 126
1158530441_1158530446 -10 Left 1158530441 18:58255922-58255944 CCTGCAGCGCAAGGCCACGGACG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG 0: 1
1: 0
2: 0
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158530446 Original CRISPR GCCACGGACGGGGCCACGGA CGG Intronic
900673979 1:3872624-3872646 GGCAGGGACAGGGCCACGGCAGG - Intronic
900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG + Intronic
901129221 1:6951728-6951750 GCCTCGGACAGGGCCCAGGAAGG - Intronic
901493900 1:9610562-9610584 GCCACCGAGCCGGCCACGGAAGG - Exonic
903251196 1:22053883-22053905 GCCACGCAAGGGGCCGTGGACGG - Intronic
904356681 1:29944835-29944857 GCCAAGGACATGGCCATGGAGGG + Intergenic
906147149 1:43566896-43566918 GCCAAGGACAGAGCCACTGAGGG + Intronic
907053501 1:51345056-51345078 GGCTCGGACGGGGCCGCGGGCGG + Exonic
920886863 1:209938106-209938128 GCCGCGGGCGGGGCGAGGGAGGG - Intergenic
922116298 1:222617905-222617927 GGCAGGGACGGGGGCAGGGACGG - Intergenic
923107959 1:230868678-230868700 CCCGGGGAGGGGGCCACGGAGGG - Intronic
1064297696 10:14093059-14093081 GCCAGGGTAGGGGGCACGGACGG + Intronic
1068989117 10:63133253-63133275 GCCACCGCCGAGGCCACGCACGG - Intronic
1070136373 10:73697903-73697925 GCCGGGGCCGGGGCCAGGGATGG - Exonic
1074204188 10:111267839-111267861 TCAACGGAAGGGGCCCCGGAGGG - Intergenic
1074312790 10:112336673-112336695 GCCATGCACAGGGCCACCGAAGG - Intergenic
1075777750 10:124999135-124999157 GCCAGGGGCGGGGCCCCAGAGGG + Intronic
1077115097 11:880536-880558 GCCATGGAGGGGCTCACGGAGGG + Intronic
1080551450 11:33376537-33376559 GCCACGGCCCGGGCGCCGGAGGG - Intergenic
1084191607 11:67501952-67501974 GGCACGGACGGCGGCACAGACGG - Exonic
1088868872 11:113875119-113875141 ACCCCGGACGGGGCCCAGGAGGG + Intronic
1091722071 12:2820844-2820866 GCCTCTGAAGGGCCCACGGATGG + Exonic
1096738852 12:53677158-53677180 GGGAAGGACGGGGCCAAGGAGGG - Intronic
1097680131 12:62641244-62641266 GCCACGGACAGGGCTTTGGAAGG - Intergenic
1097938428 12:65278686-65278708 GCGACGGACGGGGCGGCGGGAGG - Exonic
1103414621 12:120735993-120736015 GACAGGGACGGGGACAGGGATGG - Intronic
1103678678 12:122676712-122676734 GCCACGCAGGAGCCCACGGAGGG + Intergenic
1104824067 12:131695881-131695903 ACCAGGGAAGGGGCCAGGGAGGG - Intergenic
1107946062 13:45418507-45418529 GCCCCAGATGGGGACACGGAGGG + Intergenic
1107964382 13:45586284-45586306 GCCACGGATAGGGGCAGGGAAGG + Intronic
1118024080 14:61751205-61751227 CCCACGGCCGGGGCCGCGGGCGG - Intergenic
1121127477 14:91417531-91417553 GACACGGCCGGGGCCCCGGGTGG - Intronic
1121493810 14:94378398-94378420 TCCAGGGAGGGGGCCAGGGATGG + Exonic
1122270870 14:100568034-100568056 CCCACGGACGGGGCCCCGCGGGG - Exonic
1122447781 14:101781846-101781868 GCCACGGCCACGGCCACGGCTGG - Intronic
1128603823 15:69019277-69019299 GCCATGGAAGGGGGCAGGGAGGG + Intronic
1128622211 15:69160528-69160550 GCAAGGGGCGGGGCCACGGCGGG - Intergenic
1132805480 16:1773265-1773287 GCCAGGGCCGGGGCCGGGGACGG + Exonic
1133271954 16:4614635-4614657 GCGAGGGCCGGGGCCACGGGCGG - Intronic
1133318893 16:4900959-4900981 GCCAAGGACGGGGACAAGGTGGG - Exonic
1133510380 16:6452094-6452116 GCCATGGATGGAGCCATGGAAGG - Intronic
1133510432 16:6452330-6452352 GCCATGGATGGAGCCATGGAAGG - Intronic
1135572189 16:23557746-23557768 GCGGCGGCCGGGGCCCCGGATGG + Exonic
1136232972 16:28898292-28898314 GCCACTGACGGGGCCGGTGAAGG + Exonic
1139434115 16:66926330-66926352 GCCACGGCCAGGGCCAGGGCTGG - Intergenic
1141335050 16:83146795-83146817 GCCAGGGATGGGGCCAAGCATGG + Intronic
1142191733 16:88721276-88721298 GCCAGGGTCGGACCCACGGACGG - Exonic
1143610901 17:8016778-8016800 GCCAGGGGAGGGGCCACAGAAGG - Intronic
1148870550 17:50656751-50656773 GCCATGGACCAGGCCATGGAAGG - Exonic
1150463293 17:65370971-65370993 GCCAGGCACGGGGCCGGGGAAGG - Intergenic
1151974315 17:77475808-77475830 GCCACTGACCAGGCCACGGCAGG - Intronic
1152327527 17:79650336-79650358 GCCAGGGACGGGGCTGCTGATGG + Intergenic
1152337312 17:79706224-79706246 TCTAAGGACGGGGCCACGGGAGG + Intergenic
1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG + Intronic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160808927 19:1004639-1004661 GCCCCGGCCTGGGCCACGGTGGG + Exonic
1160930485 19:1567700-1567722 GCCACGGCGGGGGCCAGGGTCGG + Exonic
1161010775 19:1958533-1958555 GCCCTGGACGGGGGGACGGAGGG - Intronic
1161021316 19:2013038-2013060 GACAGGGACGGCGACACGGACGG + Intronic
1161768140 19:6217908-6217930 GGCACGGATGGGGCCGGGGAGGG - Intronic
1164917724 19:32065592-32065614 GTCACGGATGGGGCCAGTGATGG + Intergenic
1166072272 19:40394384-40394406 GCCAAGGAGGGGGCCGAGGAGGG - Exonic
1167172056 19:47839785-47839807 GCCAGGGAAGGTCCCACGGAGGG - Exonic
1168110572 19:54189487-54189509 GCCACGGTCAGGGCCCCGGGCGG + Exonic
1168651757 19:58096601-58096623 GCCAGGGCTGGGCCCACGGAGGG - Intronic
925391854 2:3500610-3500632 GCCACGGAGGCTGCCACGGAAGG + Intronic
927935018 2:27071543-27071565 GCCACGGCCACGGCCACGGCGGG + Intronic
932599379 2:73113127-73113149 GCCAGGGGCGGGGCCACCGCGGG - Intronic
938021119 2:127906454-127906476 GCCACGTGGGGAGCCACGGAGGG - Intergenic
940293420 2:152098971-152098993 GCCAAGAACGGGACCGCGGACGG - Exonic
948207142 2:236168295-236168317 GCGACGGACGGCGGGACGGACGG - Exonic
948676928 2:239602228-239602250 GACACTGACAGGGCCAGGGAAGG - Intergenic
1169123912 20:3113587-3113609 GCCAGGGGAGGGGCCACAGAAGG + Intronic
1170310450 20:14985801-14985823 GCCAGGGTCGGGGGCAGGGAAGG + Intronic
1170612925 20:17929041-17929063 GCCTCTGACGGTGCCACGGCTGG + Intergenic
1173869082 20:46330541-46330563 GGCAGGGATGGGGCCACAGAGGG - Intergenic
1175831849 20:61969046-61969068 GCCAGGGAGGGGGCTTCGGAAGG + Intronic
1179023652 21:37660838-37660860 GGCACAGACGGGGACACCGATGG - Intronic
1179654689 21:42837813-42837835 GACAAGGACGGGGCCAGGGCAGG - Intergenic
1180158604 21:45989386-45989408 GCCACGGCAGGGGCCCCGGACGG - Intronic
1181669979 22:24421471-24421493 GCCAAGGATGGGGCCAAGGGAGG + Intronic
1181755576 22:25022062-25022084 GCCAGGAACGGGGCCAGGCACGG - Intronic
1184112051 22:42401331-42401353 GGCACGGGTGGGGCCACGAAAGG + Intronic
1184684662 22:46090700-46090722 GCCACGGAGGGGGTCAGGGCTGG - Intronic
1185030507 22:48440606-48440628 CCCAGGGACAGGGCCATGGAGGG - Intergenic
1185338286 22:50280451-50280473 GCCACGAGCGGGGCCACGGGCGG - Intronic
950565245 3:13765802-13765824 GCCAGGGATGGGTCCAGGGATGG + Intergenic
950674344 3:14545513-14545535 GCCAGGGGCCTGGCCACGGATGG + Intergenic
954699509 3:52443921-52443943 TCCACGGATGGGCCCAGGGAAGG - Intronic
955343229 3:58141846-58141868 GCCACTGACCAGGCCACAGATGG + Exonic
955544142 3:60009795-60009817 GCCAGGGACTGGGACAAGGAAGG - Intronic
961649137 3:128408735-128408757 GCCCAGGTCGGGGCCAGGGAAGG + Intergenic
968508980 4:987145-987167 GCCTCGGCCGGGGCCACCGGGGG - Exonic
968703038 4:2065623-2065645 GCCACGTGCAGGGCCATGGAGGG + Exonic
969795452 4:9524536-9524558 GCCACGCAGGAGCCCACGGAGGG + Intergenic
975278094 4:72526124-72526146 GCCAGGGAAGAGGCCAGGGAAGG - Intronic
975706136 4:77113418-77113440 GCAGCGGCCGGGGCCCCGGATGG - Intergenic
981726221 4:147850268-147850290 GCCGTGGACGGGGCCAAGTAAGG + Intronic
982136651 4:152279320-152279342 GGCACTGACAGGGCCAGGGAAGG - Intergenic
984654190 4:182299765-182299787 GCCAAGGACGGGGGGAGGGAGGG + Intronic
984667825 4:182448213-182448235 GCCACGGGCCGGTCCACGCAGGG + Intronic
984863471 4:184260127-184260149 TCAACAGACGGGGCCACTGAAGG + Intergenic
999714956 5:154353055-154353077 GGCACGGATGAGGCCTCGGAGGG + Intronic
1002633742 5:180596960-180596982 CCCAGGGACGGTGCCACAGAGGG - Intergenic
1003388903 6:5695327-5695349 GCCAGGGACTGGCCCACGGGCGG + Intronic
1005959851 6:30687030-30687052 GCCAAGGTCCGGGCCAGGGACGG + Exonic
1006470121 6:34224023-34224045 GGCAGGGGCGGGGCCACGGCGGG - Intergenic
1017783224 6:157732884-157732906 GCCAAGGGCGGGGGCAAGGATGG - Intronic
1018071949 6:160172690-160172712 GCCACTGAGGGGACCAGGGAAGG - Intronic
1019173382 6:170147289-170147311 GCCAAGGAAGGAGCCACGGAGGG + Intergenic
1023842459 7:44104887-44104909 GCCAGGGAAGCGGCCAGGGACGG + Exonic
1029238598 7:99143394-99143416 GCGAGGGGCGGGGCCAGGGAAGG + Intronic
1029448411 7:100627391-100627413 GCCACGGCCTGGGCCACGGCGGG + Exonic
1030058504 7:105603791-105603813 GGCAGGGACGAGGCCACAGAAGG - Intergenic
1034535116 7:151721385-151721407 GCCAGGGCCGGGGCCAGGGCCGG + Intronic
1034911613 7:155002793-155002815 GGGACGGACGGGGACGCGGACGG + Intronic
1035376409 7:158409701-158409723 GCCAGGGAAGGGGCCAGGTAGGG + Intronic
1036705399 8:11042819-11042841 GCCAAGGCAGGGGCCATGGAAGG - Intronic
1038088169 8:24222913-24222935 GCCACGCATGGGGCCACGTAGGG + Intergenic
1039441134 8:37596042-37596064 GCCACAGACGGGGCCTGTGAAGG - Intergenic
1041457240 8:58074315-58074337 GCAATGGACGGGCCCACCGATGG - Intronic
1047162153 8:122392555-122392577 CCCAAGGACAGGGCCAGGGATGG + Intergenic
1049224838 8:141445216-141445238 GCCTCGCGCGGGGCCACGGGTGG - Intergenic
1049383893 8:142331291-142331313 GCCAGGGGAGGGGCAACGGATGG - Intronic
1049615173 8:143572785-143572807 GCCCCGGGCGGGACCACGGACGG + Exonic
1060493477 9:124101485-124101507 GCCACTCAGGGGGCCAAGGAGGG + Intergenic
1061195794 9:129106493-129106515 TCCACTCACGGGGCCACCGAAGG - Intronic
1061366160 9:130173178-130173200 CACACGAACGGGGCCAGGGAGGG - Intronic
1062074381 9:134576587-134576609 GCCAGGGAGGGGGCCAGGCAGGG - Intergenic
1062359166 9:136179244-136179266 GCCATGTACGGGGCCCCGGGGGG - Intergenic
1062543305 9:137051081-137051103 GCCACGGAAGGGGACACTGGGGG - Exonic
1185520769 X:736766-736788 GCCACGAACAGGGCCATGGGGGG - Intergenic
1189849716 X:45166278-45166300 GCCAAGTACTGGGCCAGGGATGG + Intronic
1190783958 X:53625802-53625824 GCCAGGGCCGGGGCCAGGGCCGG + Intronic