ID: 1158530624

View in Genome Browser
Species Human (GRCh38)
Location 18:58256593-58256615
Sequence GCAGGACGAACTCCGCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158530615_1158530624 21 Left 1158530615 18:58256549-58256571 CCTGGAGGCATCGCCTCGAGCTG No data
Right 1158530624 18:58256593-58256615 GCAGGACGAACTCCGCGGAGAGG No data
1158530619_1158530624 8 Left 1158530619 18:58256562-58256584 CCTCGAGCTGGCAGGATGGCTCC No data
Right 1158530624 18:58256593-58256615 GCAGGACGAACTCCGCGGAGAGG No data
1158530614_1158530624 22 Left 1158530614 18:58256548-58256570 CCCTGGAGGCATCGCCTCGAGCT No data
Right 1158530624 18:58256593-58256615 GCAGGACGAACTCCGCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158530624 Original CRISPR GCAGGACGAACTCCGCGGAG AGG Intronic