ID: 1158532002

View in Genome Browser
Species Human (GRCh38)
Location 18:58271545-58271567
Sequence CTAGCTAATCTCACTCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158532002_1158532003 -9 Left 1158532002 18:58271545-58271567 CCTTTTAGAGTGAGATTAGCTAG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1158532003 18:58271559-58271581 ATTAGCTAGAAAAGAAATTAAGG 0: 1
1: 0
2: 1
3: 54
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158532002 Original CRISPR CTAGCTAATCTCACTCTAAA AGG (reversed) Intronic
902660537 1:17898428-17898450 CAACCTAATCTCACACTGAAAGG + Intergenic
906898598 1:49807436-49807458 ATAGATACTCTCATTCTAAAAGG - Intronic
907990392 1:59576626-59576648 CTAGCAAATATCACTCTCACTGG - Intronic
913269359 1:117077841-117077863 GTAGCTAAGTTCACTCTAAAGGG + Intronic
918677087 1:187300484-187300506 CTGGCCAATGTCACTCTGAAAGG - Intergenic
922268123 1:224006672-224006694 CTAGCCAATATAAATCTAAATGG + Intergenic
1066725572 10:38388936-38388958 CTAGCCAATATAAATCTAAAGGG - Intergenic
1071007951 10:80904747-80904769 ATAGCTAGTATCACACTAAATGG - Intergenic
1071426984 10:85567856-85567878 CTAGCTAACATCATTCTTAATGG + Intergenic
1074467179 10:113693905-113693927 CTAGCTAAGCTCACTGGCAAAGG - Intronic
1075577778 10:123592027-123592049 CCAGCTAACCTCAGTCTTAATGG + Intergenic
1083499596 11:63091789-63091811 ATAGCCAATATCATTCTAAATGG + Intronic
1086557949 11:88133998-88134020 CAAGGTAATCTCATTCCAAAGGG + Intronic
1089985724 11:122811284-122811306 CTAACTAATGTCTCTTTAAAGGG - Exonic
1092109729 12:5950608-5950630 CTAGATAATTTCATTGTAAAGGG + Intronic
1093710016 12:22319814-22319836 CTAGCTAAGCAGACTCCAAATGG - Intronic
1094083912 12:26567435-26567457 CTAGATAATATCAATCGAAATGG - Intronic
1094213027 12:27912450-27912472 CAACCTACTCTCTCTCTAAAGGG + Intergenic
1100588754 12:96004522-96004544 CTACCTTAACTCACCCTAAAAGG + Intronic
1100942610 12:99740698-99740720 CTGGCTTATCTCACTGGAAATGG + Intronic
1101906759 12:108832608-108832630 TTAGCTAATCTCTCTCCAAATGG - Intronic
1106334623 13:28772407-28772429 CTAGCCAATATCACACTGAATGG - Intergenic
1109782943 13:67136598-67136620 CTAGCTAAACTCTATATAAATGG + Intronic
1109963178 13:69658693-69658715 CTTGATAATTTCACTCCAAAAGG + Intergenic
1114036215 14:18630649-18630671 CTAGCCAATGTCATTCTTAATGG - Intergenic
1114122421 14:19684386-19684408 CTAGCCAATGTCATTCTTAATGG + Intergenic
1117465109 14:55985219-55985241 CTTGGGAATCTCACTGTAAAAGG + Intergenic
1117518520 14:56527003-56527025 CTAGAAAATCTCACTCCACAGGG + Intronic
1119378869 14:74215944-74215966 CTAATTAAGCTCACTGTAAAGGG + Intergenic
1123429976 15:20206258-20206280 CTAGCTAATCTCACTTGGCAAGG - Intergenic
1129074694 15:72983497-72983519 ATAGATAATCTCATTCCAAATGG + Intergenic
1130962372 15:88670040-88670062 ATAGCTAATATTACACTAAATGG + Intergenic
1137486291 16:48894308-48894330 CTAGCTAATGAGAGTCTAAATGG + Intergenic
1137895645 16:52208929-52208951 CTAACTAATCTTTCTCTCAAGGG + Intergenic
1139317824 16:66088411-66088433 CTAGCTAATCTGAATCTACACGG - Intergenic
1203116230 16_KI270728v1_random:1493430-1493452 CTAGCTAATCTCACTTAGCAAGG + Intergenic
1143532351 17:7512753-7512775 CTTGCTTCTCTCACTCTATAGGG + Exonic
1144052344 17:11507883-11507905 CTCGCCAGTCTCACACTAAATGG - Intronic
1144170901 17:12658995-12659017 CTTGCTACTCTCACTTTAAGAGG - Intergenic
1146975867 17:37111246-37111268 CTAGCTAATCATTCTCTACAAGG + Intronic
1149159192 17:53669625-53669647 ATAGCTAATGTCATTCTAGATGG + Intergenic
1150949240 17:69783840-69783862 CCAGCTGATCTCACTATACATGG + Intergenic
1153655365 18:7277463-7277485 CGAGCTATTCTAATTCTAAAGGG + Intergenic
1156255802 18:35395245-35395267 ATAGCTAACATCACACTAAATGG - Intergenic
1158069308 18:53452008-53452030 CCAGCTAAGCTCACTCTAGCAGG - Intronic
1158532002 18:58271545-58271567 CTAGCTAATCTCACTCTAAAAGG - Intronic
1158886132 18:61829199-61829221 CTAGCGAATATCACTGTAAGGGG + Intronic
1159764601 18:72473106-72473128 TTAGCAAACCTCACTCTGAAGGG - Intergenic
1166335525 19:42104343-42104365 TTATCTATTCTCACTCTAGAAGG + Intronic
1167850902 19:52200962-52200984 CCAGATAATATCACCCTAAACGG - Intronic
925854106 2:8113096-8113118 CTAGCTAAGATCACTGGAAAAGG + Intergenic
928171618 2:29007971-29007993 CTACCTACTCTCCCTTTAAAGGG + Intronic
928781653 2:34829657-34829679 ATAGCTAGTATCATTCTAAATGG - Intergenic
931471148 2:62538869-62538891 TTATCTAATCTACCTCTAAAAGG - Intergenic
938441193 2:131334758-131334780 CTAGCCAATGTCATTCTTAATGG - Intronic
1170616001 20:17951774-17951796 GTAGGTCATCTCATTCTAAAAGG + Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1178354574 21:31899937-31899959 CTAGCTAATTTCTTTTTAAATGG + Intronic
1180460343 22:15557708-15557730 CTAGCCAATGTCATTCTTAATGG - Intergenic
1180570325 22:16710604-16710626 ATAGCTAATATCATGCTAAATGG + Intergenic
955226967 3:57068302-57068324 CATTCTTATCTCACTCTAAAAGG + Intronic
955797782 3:62655664-62655686 CTAGGGAACCTCACTCTGAAGGG - Intronic
957108238 3:75919147-75919169 ATAGCTAATATCATGCTAAATGG - Intronic
958110735 3:89140909-89140931 ATAGCTAATATTTCTCTAAAGGG + Intronic
959827825 3:110820720-110820742 CTACCTAATCTTACTTAAAATGG + Intergenic
960098756 3:113715540-113715562 GTAGCTTATCTCATTCTAAATGG - Intergenic
961246950 3:125462737-125462759 TTATCTAATGTCAATCTAAAAGG - Intronic
965085939 3:164098321-164098343 ATAGCTAATATCACACTTAATGG - Intergenic
965783318 3:172310863-172310885 TTACCTCATCCCACTCTAAAAGG - Exonic
971073103 4:23117001-23117023 CTAGCTAAACTAACTCAAGATGG - Intergenic
974740506 4:66000065-66000087 CTAGATAATCTCACATAAAATGG + Intergenic
979336117 4:119464855-119464877 CTAGCCAATATAAATCTAAATGG + Intergenic
988052178 5:26044651-26044673 CTAGCTAATAACACTATAACAGG + Intergenic
988055717 5:26092825-26092847 CTAGGAAATCTTACTCTAATAGG - Intergenic
991047209 5:62235214-62235236 CTAGCTAATCTCACTTGGCAAGG - Intergenic
1006278454 6:33026300-33026322 ATAGCTAATATCATTCTCAATGG - Intergenic
1010518667 6:76805963-76805985 ATAGCTAGTATCATTCTAAATGG + Intergenic
1013144402 6:107373678-107373700 CTAGCTAATGTCCCTCTACAAGG + Intronic
1020570532 7:9854995-9855017 CTAAATAATCTATCTCTAAATGG + Intergenic
1024067686 7:45755017-45755039 CTAGCCAATATAAATCTAAATGG - Intergenic
1026265657 7:68793985-68794007 TTATCTATTCTCACTATAAATGG - Intergenic
1028194251 7:87887191-87887213 CTAGCTATTGTAACTCTATAGGG + Intronic
1032808190 7:135379512-135379534 GTAGCAAATCTTACTCTAAATGG + Intronic
1033215646 7:139491514-139491536 CTAGCAAATCTCATTCATAATGG - Intergenic
1035093675 7:156334573-156334595 CTATCTAATCTCACTGTCAGTGG + Intergenic
1040813159 8:51479850-51479872 CTATCTAATCTATCTGTAAAGGG - Intronic
1041883018 8:62774515-62774537 ACAGCTAGTCTCACACTAAATGG - Intronic
1048557401 8:135493966-135493988 CTACCAAAGCTCACTCAAAAAGG - Intronic
1050390824 9:5142449-5142471 CTAGCTATTCTAACTGTGAATGG + Intronic
1050840166 9:10138929-10138951 ATAGCTAATATCACACCAAATGG + Intronic
1051446328 9:17143020-17143042 CTAGTTAAACTTGCTCTAAAAGG - Intronic
1052361585 9:27566915-27566937 CTTGCCAACCACACTCTAAATGG - Exonic
1052378818 9:27747280-27747302 CTGGCTAATCTCACTCGAATGGG + Intergenic
1052628682 9:31008788-31008810 ATAGCTAATATCATACTAAATGG + Intergenic
1054840906 9:69738415-69738437 CTAGATAATCCCCCTCTACAAGG - Intronic
1054983981 9:71240311-71240333 CTAGCTAATCTCTCTTCTAATGG - Intronic
1055288670 9:74758665-74758687 ATAGCTAACCTCATTCTTAATGG + Intronic
1055570133 9:77608242-77608264 ATAGATATTCTCATTCTAAAAGG - Intronic
1060272989 9:122160404-122160426 CTGGCTAATCTGAATCTACACGG + Intronic
1191064490 X:56333166-56333188 ATAGCCAATATCACACTAAATGG - Intergenic
1191602831 X:63028289-63028311 CTAACTAACCTCATACTAAATGG - Intergenic
1194267756 X:91776698-91776720 CTAGGCATTCTAACTCTAAAAGG - Intergenic
1194784488 X:98065030-98065052 GTAGCTAAGCTCAGACTAAAAGG - Intergenic
1197437023 X:126442751-126442773 CCAGCTAATATCACACTGAATGG - Intergenic
1198645120 X:138798171-138798193 CTAGCCAATATCATACTAAATGG - Intronic
1200584967 Y:4997623-4997645 CTAGGCATTCTAACTCTAAAAGG - Intergenic
1201785559 Y:17773899-17773921 TTAGCTAATATCACACTCAAAGG + Intergenic
1201815994 Y:18132089-18132111 TTAGCTAATATCACACTCAAAGG - Intergenic