ID: 1158536322

View in Genome Browser
Species Human (GRCh38)
Location 18:58311435-58311457
Sequence CCCAGGGGGTTGAGGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2543
Summary {0: 1, 1: 0, 2: 82, 3: 595, 4: 1865}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158536322_1158536337 18 Left 1158536322 18:58311435-58311457 CCTTGCACCCTCAACCCCCTGGG 0: 1
1: 0
2: 82
3: 595
4: 1865
Right 1158536337 18:58311476-58311498 TAGGACCCCAGCGTGACCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 95
1158536322_1158536330 -9 Left 1158536322 18:58311435-58311457 CCTTGCACCCTCAACCCCCTGGG 0: 1
1: 0
2: 82
3: 595
4: 1865
Right 1158536330 18:58311449-58311471 CCCCCTGGGCTCCCAGCTGGGGG 0: 1
1: 0
2: 9
3: 49
4: 433
1158536322_1158536328 -10 Left 1158536322 18:58311435-58311457 CCTTGCACCCTCAACCCCCTGGG 0: 1
1: 0
2: 82
3: 595
4: 1865
Right 1158536328 18:58311448-58311470 ACCCCCTGGGCTCCCAGCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 364
1158536322_1158536338 19 Left 1158536322 18:58311435-58311457 CCTTGCACCCTCAACCCCCTGGG 0: 1
1: 0
2: 82
3: 595
4: 1865
Right 1158536338 18:58311477-58311499 AGGACCCCAGCGTGACCTGTGGG 0: 1
1: 0
2: 1
3: 15
4: 121
1158536322_1158536334 -1 Left 1158536322 18:58311435-58311457 CCTTGCACCCTCAACCCCCTGGG 0: 1
1: 0
2: 82
3: 595
4: 1865
Right 1158536334 18:58311457-58311479 GCTCCCAGCTGGGGGTCTTTAGG 0: 1
1: 0
2: 2
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158536322 Original CRISPR CCCAGGGGGTTGAGGGTGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr