ID: 1158538119

View in Genome Browser
Species Human (GRCh38)
Location 18:58326692-58326714
Sequence TTTCCTTTGTGAGTTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158538119_1158538122 30 Left 1158538119 18:58326692-58326714 CCAGGAGCAACTCACAAAGGAAA 0: 1
1: 0
2: 1
3: 20
4: 260
Right 1158538122 18:58326745-58326767 AATATTCAACTTCATAAATAAGG 0: 1
1: 0
2: 14
3: 72
4: 628
1158538119_1158538121 4 Left 1158538119 18:58326692-58326714 CCAGGAGCAACTCACAAAGGAAA 0: 1
1: 0
2: 1
3: 20
4: 260
Right 1158538121 18:58326719-58326741 CCTGATAGCTAATATGTATATGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158538119 Original CRISPR TTTCCTTTGTGAGTTGCTCC TGG (reversed) Intronic
900920907 1:5669776-5669798 CCTCCTCTGTGAATTGCTCCTGG - Intergenic
902776774 1:18679852-18679874 TTGCCTTTGTGTTTTGCGCCAGG + Intronic
903277244 1:22230073-22230095 TGTCGTTGGTGAGTTCCTCCAGG + Intergenic
903529992 1:24022802-24022824 TTTTCTTTGACAGTTGCTCAGGG + Intergenic
904957937 1:34303507-34303529 TTTCCTTTGTGATTTCATCTTGG + Intergenic
905990510 1:42334347-42334369 TTTCCTCTGTGATTTCCTCCGGG - Intronic
906980102 1:50620932-50620954 TTTCTTTTGTTAGGTGTTCCGGG + Intronic
907471068 1:54673798-54673820 CTTTCTTTGTGAGTGGCCCCTGG + Exonic
909604999 1:77499176-77499198 TTTCCTTTCCAACTTGCTCCAGG + Intronic
910827065 1:91420396-91420418 TTTCCTTTTTGATTAGCTCCTGG + Intergenic
912180196 1:107209904-107209926 TTTTCTGTTTAAGTTGCTCCAGG + Intronic
912194361 1:107379973-107379995 GTTTCTTTGAGAGTTGCTCCTGG + Intronic
912579409 1:110706479-110706501 ATTCCTGTGTGATCTGCTCCTGG - Intergenic
912599270 1:110911625-110911647 TTACCTTTTTGATTTGCTGCTGG - Intergenic
912963173 1:114213985-114214007 TTTCCTTAGGGAGATGCTGCTGG - Intergenic
913611660 1:120514864-120514886 TTCCCTGGGCGAGTTGCTCCCGG + Intergenic
914579532 1:149007375-149007397 TTCCCTGGGCGAGTTGCTCCCGG - Exonic
915907418 1:159888885-159888907 TTTCCTTTATGAGCTCCTTCAGG + Intronic
916408638 1:164523230-164523252 TGTCCTCTGTGAATTGTTCCTGG - Intergenic
916575392 1:166062487-166062509 TTGATTTTGTGAGTGGCTCCTGG + Intronic
918950212 1:191126494-191126516 TTTCCTTTGTTAGCCGTTCCAGG - Intergenic
919555446 1:199046646-199046668 TTTCTTTTGTTAGGTGCTCTGGG - Intergenic
920891770 1:209993663-209993685 TTTCTTTTGTTAGGTGTTCCGGG - Intronic
921071066 1:211657920-211657942 TTTCCTTTGTGAGATTTTCCTGG - Intergenic
923265243 1:232307465-232307487 TGTCCTTTGGGACTTGATCCGGG - Intergenic
1064870450 10:19931196-19931218 TTTCCTTTGTGAGCTGAACTTGG + Intronic
1067077933 10:43198626-43198648 TTTCCTTGGTCAGTGTCTCCAGG - Intronic
1067308681 10:45092071-45092093 TTTCCTTTGTGGGCTGGTTCAGG + Intergenic
1069273012 10:66554070-66554092 TTTCCTTTGTGCTTGTCTCCTGG + Intronic
1072199717 10:93147515-93147537 TTCCATTTGACAGTTGCTCCAGG + Intergenic
1072690073 10:97566966-97566988 TTTTCTTTGTCAGATGCTGCAGG + Intronic
1073074800 10:100817153-100817175 CTTCATTTGTGATTTGCTCATGG + Intronic
1075130718 10:119736635-119736657 GTTCCTTTTTGAGTTGCTTTGGG + Intronic
1075809334 10:125213252-125213274 TTTCCTATCTAAGTTGCTTCAGG - Intergenic
1076539729 10:131206438-131206460 CTTCCTTTGAGGGCTGCTCCAGG - Intronic
1077417771 11:2432832-2432854 TTTCCTGTCTGAGGGGCTCCGGG - Intergenic
1078345121 11:10541071-10541093 TTTCCCTTGCTAGCTGCTCCAGG - Intronic
1079747931 11:24156079-24156101 TGTCCTTTGTTAGGTGTTCCAGG - Intergenic
1080183312 11:29449361-29449383 TTTCCTTTTTGGCTTGCTGCTGG - Intergenic
1080255205 11:30282470-30282492 TTTCCTTTGTTAGGTGTTCCAGG - Intergenic
1080255876 11:30289879-30289901 TTTCTTTTGTTAGTTATTCCTGG - Intergenic
1081114272 11:39179510-39179532 TTTGCTTTTTCAGTTTCTCCTGG + Intergenic
1081837177 11:46165337-46165359 TTCCCTTTGTGAGGTGTTTCAGG - Intergenic
1082694020 11:56337547-56337569 TTTCTTTTGTTAGGTGTTCCAGG - Intergenic
1083292389 11:61697203-61697225 ATTCCTTTGTGGGTAGCCCCAGG + Intronic
1085731706 11:79005376-79005398 TTACCTTTTTGATGTGCTCCTGG - Intronic
1087844725 11:102960283-102960305 CTTGCTTTGTGACTTGCTTCGGG + Intergenic
1088532312 11:110823924-110823946 TTTACTTTATGAGTTTTTCCTGG - Intergenic
1089561764 11:119346723-119346745 GTGCCTTTGTGAATTCCTCCTGG - Intergenic
1090612195 11:128481270-128481292 TTTACTGTGTGAGTTGCTTAAGG + Intronic
1094036328 12:26075846-26075868 TTGCCTGAGTGAGTTGTTCCTGG - Intronic
1094177519 12:27556613-27556635 TTTCCATTGTGCTTTGCTGCTGG + Intronic
1099572951 12:84348484-84348506 TTTCCTTTCTTAGGTGTTCCAGG + Intergenic
1101186169 12:102282619-102282641 TTTCTTTTGGAAGATGCTCCTGG + Intergenic
1101937816 12:109072596-109072618 TTACCTTTTTGAATTGATCCTGG + Intronic
1103477173 12:121227321-121227343 TTTCTTTGGTGAATTTCTCCTGG - Intronic
1104912644 12:132247038-132247060 TTTCCTTTGTGTTTTGCCCATGG - Intronic
1105945413 13:25185580-25185602 AATCATTTGTCAGTTGCTCCAGG - Intergenic
1106432698 13:29695960-29695982 TCACCTTTGTGACTAGCTCCTGG + Intergenic
1106939368 13:34760497-34760519 TCTCCTTTGTGAATTACTCAAGG + Intergenic
1108177902 13:47812660-47812682 TTTCCTTTGGAAGTTACTACTGG - Intergenic
1108821522 13:54356524-54356546 TTTTCTTGGTGAGGTGCTCTGGG + Intergenic
1110898157 13:80783450-80783472 TTTCCTTCCTGAGTAGCTCATGG - Intergenic
1111693297 13:91592421-91592443 TTTCTTTTGTGAGGTGTTCTGGG + Intronic
1113593481 13:111516138-111516160 CTGCCTTTGTGAGTTCCGCCTGG - Intergenic
1114396069 14:22362933-22362955 TTTCCTTTGTTAGGTGTTCTGGG + Intergenic
1115641053 14:35335818-35335840 TGTCCTTTCTCAGTTTCTCCCGG - Intergenic
1117025931 14:51620323-51620345 TTTCCTTCATGAGTTACTGCTGG - Intronic
1117090018 14:52239995-52240017 TTTCCTTTGTGGTATGTTCCTGG - Intergenic
1117159575 14:52975356-52975378 TTTCATTTATGACTTGCTCAAGG + Intergenic
1117477841 14:56115596-56115618 TTGTTTTAGTGAGTTGCTCCAGG - Intergenic
1118614649 14:67567063-67567085 TCCCCTTTGTAACTTGCTCCTGG + Intronic
1119160763 14:72450929-72450951 TTCCCTTTCTGACTTGTTCCTGG + Intronic
1119426940 14:74541853-74541875 TTTCCTTTGTCAGTTCTGCCCGG - Intronic
1119778571 14:77263226-77263248 CTTCCTTTTTGAGTCCCTCCTGG - Intergenic
1120852140 14:89180797-89180819 TTTGCTTTTTCAGTTCCTCCAGG - Exonic
1125765411 15:42132194-42132216 TTTCTTTTGTGAGCTGTGCCAGG - Intergenic
1128868131 15:71131238-71131260 TTTCCATTGTGATTTTCTGCTGG - Intronic
1129818785 15:78581079-78581101 TTTCCCTGGTGAGTTCCTTCAGG - Intronic
1130139756 15:81215605-81215627 TTTCTTTTGTTAGGTGTTCCAGG + Intronic
1130442761 15:83971972-83971994 TTTGTTTTGTGAGTTTCTCCAGG - Intronic
1130894900 15:88162386-88162408 TTTCCTTTGTGAGTCCTTACTGG - Intronic
1132022268 15:98372956-98372978 TCTCCTTTGGGAGATGCTCTAGG - Intergenic
1132181237 15:99754275-99754297 CTTCCCCTGTGAGTTTCTCCAGG + Intergenic
1132952830 16:2574078-2574100 TTTCATTTCTGGGTTGCTCCTGG + Intronic
1132961521 16:2626090-2626112 TTTCATTTCTGGGTTGCTCCTGG - Intergenic
1134338180 16:13320523-13320545 TTTCCTTTATGTGTGGCTCTTGG - Intergenic
1135492483 16:22921881-22921903 TCTCCTATGTGACTTGCTCCAGG - Intergenic
1135804502 16:25530094-25530116 TTTCCCTGGAGAGTTCCTCCTGG - Intergenic
1137779516 16:51086069-51086091 TTTCATCTTTGAGTTGCTCTAGG + Intergenic
1137786974 16:51147326-51147348 TTTTTTTTGTGATTTGCTTCAGG - Intronic
1137802525 16:51274514-51274536 TTTTCTTTGTCTGTTGATCCAGG - Intergenic
1138667119 16:58580285-58580307 TTTTATTTGTAAGTTGCTCAAGG - Intronic
1139163872 16:64542885-64542907 TTTCCTTTGGAAGGAGCTCCTGG + Intergenic
1139845784 16:69920246-69920268 TTGTCTTAGTAAGTTGCTCCAGG + Intronic
1140451827 16:75077090-75077112 TCTCCTTTAAGAGTTGATCCAGG + Intronic
1141304121 16:82845075-82845097 TTTTCTTTGGGAGGTGATCCAGG + Intronic
1142309433 16:89303708-89303730 TGTCCTATGTGGGGTGCTCCAGG - Intronic
1142733222 17:1877256-1877278 TTCCCCTCGGGAGTTGCTCCAGG - Exonic
1143107303 17:4536167-4536189 TTGGCTTTGTGAGTAGCCCCGGG + Exonic
1148015079 17:44515987-44516009 TTTCCTTTGAAAAATGCTCCTGG - Intergenic
1148898317 17:50854038-50854060 TCTCCTTTGGCAGATGCTCCTGG + Intergenic
1149305154 17:55340286-55340308 TTTCCTGTGTGGATTGCTCTTGG + Intergenic
1149830891 17:59870843-59870865 TTTGCTGAGTTAGTTGCTCCGGG - Intronic
1150050115 17:61953573-61953595 TTGCCTTTGTCAGTTTCTACAGG - Intronic
1155638828 18:27988012-27988034 TTTCCTTTCTGAGTCTCTGCTGG - Intronic
1156419252 18:36933394-36933416 TTTCCTTTGTTAGGTGTTCCAGG + Intronic
1156734516 18:40237385-40237407 TGTCCTTTGTAAGTTGCTAATGG - Intergenic
1156862987 18:41859883-41859905 TTTCCTTTGTGATCTGCTTTAGG - Intergenic
1156994425 18:43448466-43448488 TTTCTTTTGTTAGGTGTTCCAGG - Intergenic
1157512340 18:48285839-48285861 TTTTGTTTGTTTGTTGCTCCTGG + Intronic
1158062111 18:53357030-53357052 TTTGCTTTTTAAGTTGATCCAGG + Intronic
1158538119 18:58326692-58326714 TTTCCTTTGTGAGTTGCTCCTGG - Intronic
1161060631 19:2213103-2213125 TGTCCTGTGTCAGTGGCTCCTGG + Intronic
1162858017 19:13483987-13484009 TTTCCCTACTGAGGTGCTCCTGG - Intronic
1165073911 19:33270305-33270327 TTTCCTTCGTTAGATGCTCCGGG - Intergenic
1168555233 19:57333303-57333325 TTTCCCTTCTGAGTTGCTGAGGG + Intergenic
925561888 2:5204930-5204952 TGTCCTTTGTGTGTTGCTGTGGG + Intergenic
926258048 2:11227254-11227276 TTTCCTTTATGAGATGCTAGTGG - Exonic
926510024 2:13763968-13763990 TTTCTCTTGTGACTTCCTCCTGG - Intergenic
927089772 2:19701384-19701406 TTGCCTCTGTGAGTTGTTCAGGG - Intergenic
927150294 2:20191765-20191787 TTTTCTCTATGTGTTGCTCCAGG - Intergenic
927995583 2:27483367-27483389 TCTCCTTTTTTAGTTGCTCTGGG - Exonic
929416709 2:41749502-41749524 TTTTCTTTGTCATTTGTTCCCGG - Intergenic
929956329 2:46461197-46461219 TTTGCTTTGGAAATTGCTCCTGG - Intronic
931617797 2:64178360-64178382 TTACATTTGTGAATTTCTCCTGG + Intergenic
931669776 2:64636634-64636656 CTTCCTGTTTGAGTTCCTCCTGG + Exonic
934522074 2:95025878-95025900 TTGAGTTTGTGAGTGGCTCCTGG + Exonic
936024370 2:109020214-109020236 TTGCCTGTGTGCGCTGCTCCTGG - Intergenic
936403834 2:112185332-112185354 TCTCCATTGTGAGTATCTCCAGG + Exonic
938646230 2:133333217-133333239 ATTCTTTTCAGAGTTGCTCCAGG + Intronic
939228483 2:139394922-139394944 TTTCCTTTGAGGGTTTCTCTTGG + Intergenic
939321410 2:140628071-140628093 TTTCCTTTGAAAGTGGATCCAGG + Intronic
940756913 2:157693827-157693849 TTTCTCTTGTAAGCTGCTCCAGG - Intergenic
942340882 2:174945119-174945141 TTTTCTGTTTGAATTGCTCCTGG - Intronic
942677795 2:178446674-178446696 TTTAATATGTGAGATGCTCCAGG + Intronic
942758924 2:179375039-179375061 TTTCATTAGTGAAATGCTCCTGG + Intergenic
947072594 2:226307460-226307482 GTGCCTCTGTCAGTTGCTCCAGG - Intergenic
948110749 2:235453735-235453757 TGACCTTGGTGAGTTGCTGCAGG + Intergenic
948595786 2:239078646-239078668 GTGCCTTTCTGAGTTGCTCTTGG - Intronic
948798059 2:240415452-240415474 TTAACTTTGTGAGTTTCTCTGGG + Intergenic
1169094466 20:2884340-2884362 GAACCTTTGTGAGTTGCTACTGG - Intronic
1169532177 20:6497088-6497110 TGCCCTCTGTGAGGTGCTCCTGG + Intergenic
1171016451 20:21546436-21546458 TTTCCTTTGTTGGCTTCTCCAGG + Intergenic
1171505516 20:25629906-25629928 TTTCCTATCTAAGTTGCTTCAGG - Intergenic
1171773768 20:29347403-29347425 CCTCCTCTGTGAATTGCTCCTGG + Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1174034275 20:47658060-47658082 TTTCCTTTGTGAGCTTCTGGGGG + Exonic
1174743128 20:53035207-53035229 TCTCCTCTGTGATTTGCTGCTGG + Intronic
1175054337 20:56184703-56184725 CTTCCTTTGTGAGTCCCACCTGG + Intergenic
1175248558 20:57595738-57595760 TTTCCTTTGTCAGTGACTCCAGG + Intergenic
1175460716 20:59149982-59150004 TTTCCTCTGTGACCTGCTACGGG + Intergenic
1175475587 20:59271618-59271640 CTTCCTCTGTGAGTGGCTGCAGG - Intergenic
1175522146 20:59608814-59608836 TCTCATTTCTGATTTGCTCCTGG + Intronic
1176267381 20:64217306-64217328 TTTCTCTTCTGTGTTGCTCCTGG + Intronic
1176307175 21:5129846-5129868 TTTCCTTTCTGAGTGGCGCTTGG - Intergenic
1176705543 21:10117949-10117971 TTTCCATTATGATTTGCTCTTGG + Intergenic
1176870107 21:14077141-14077163 TTTCCTTTGTTTTTTCCTCCTGG - Intergenic
1178239123 21:30879182-30879204 TTTCTTTTCAGAGTTGCTCAAGG - Intergenic
1179507050 21:41848136-41848158 TTGTCTTTGTGAGTGGCCCCTGG - Intronic
1179849884 21:44132184-44132206 TTTCCTTTCTGAGTGGCGCTTGG + Intergenic
1180061700 21:45388631-45388653 TTTCCTTCCTGAGGGGCTCCTGG - Intergenic
1180319231 22:11305519-11305541 CCTCCTCTGTGAATTGCTCCTGG + Intergenic
1182952684 22:34391977-34391999 TTTCCACAATGAGTTGCTCCTGG + Intergenic
1184692006 22:46121717-46121739 TGTCATTTGTGAGGTGCCCCAGG + Intergenic
951758457 3:26118189-26118211 TTTCTTTTGTTAGGTGTTCCAGG - Intergenic
954140750 3:48603936-48603958 TCTCCTTTGTGGATGGCTCCGGG - Intronic
956260879 3:67339705-67339727 TTACCTTTGTGATGTGCTGCTGG - Intergenic
956272156 3:67459497-67459519 TTTGCTTGGTGATTTGCTCAAGG + Intronic
957132721 3:76243054-76243076 TTTTGTTTGTGAGTTGTTACAGG - Intronic
957678181 3:83397343-83397365 TTACCTTTTTGAGCTGCTGCTGG - Intergenic
959015998 3:101134591-101134613 TTTCCTTTCTGAGTTTCCACAGG + Intergenic
959460865 3:106623678-106623700 TTTCCTTGATGAATGGCTCCTGG + Intergenic
960568006 3:119156100-119156122 TTTCCTTTGTTAGGTGTTCTGGG + Intronic
961169404 3:124785794-124785816 TTTCCTAAGTGAGTTTCTCTAGG - Intronic
962120546 3:132556014-132556036 TATGCTTTGTGAGTGGCTACTGG + Intergenic
962261284 3:133909685-133909707 TTTCCTTTGTGGGTTGGTTTGGG + Intergenic
963692930 3:148527336-148527358 TTGACTCTGTGAATTGCTCCGGG - Intergenic
963863312 3:150333025-150333047 CTTCCTTTGTGTATTGGTCCAGG - Intergenic
964222222 3:154359976-154359998 TTTCCTTGTTTGGTTGCTCCTGG - Intronic
965224712 3:165973051-165973073 TTTCCTTTATAAGTTGCCTCAGG + Intergenic
965649789 3:170921742-170921764 TTAGCTTTTTGATTTGCTCCTGG - Intergenic
967074496 3:185989985-185990007 TCTCCTTTCTGAGTTTCTACAGG - Intergenic
967860380 3:194146970-194146992 TATCCTTTTTGAACTGCTCCTGG - Intergenic
970770505 4:19606599-19606621 TTTCCCTATTCAGTTGCTCCTGG + Intergenic
972686980 4:41361043-41361065 TTTCTTTTGCCAGCTGCTCCAGG + Intronic
972838081 4:42899409-42899431 TTTTGTTTCTGAGTTCCTCCAGG - Intronic
972941242 4:44197342-44197364 TTTCCTTTTTCACTTGTTCCAGG - Intronic
977568450 4:98606391-98606413 TTTGCTTTATGAGCTACTCCAGG + Intronic
979433620 4:120662654-120662676 TTTCCTTTGTTGGTTGCTTTTGG + Intergenic
980377807 4:131974655-131974677 TTTCCATTATGATTTGCTCTTGG + Intergenic
980469662 4:133234479-133234501 TTTCTTTTGTTAGTGGTTCCAGG - Intergenic
980645315 4:135635909-135635931 TTTCCCTTGGGAGGAGCTCCTGG - Intergenic
982749594 4:159144100-159144122 TTTCAATAGTGATTTGCTCCAGG - Intronic
983611165 4:169646777-169646799 TTTCCTCTGTGGTTTTCTCCTGG - Intronic
986325357 5:6668953-6668975 CTGCCTGTGTGAGTGGCTCCTGG + Exonic
988342301 5:29988665-29988687 GTTCATTTTTGAGTTGCTTCAGG + Intergenic
991553704 5:67871826-67871848 GTTCCATTGTGAGTTGCTTGAGG + Intergenic
993853030 5:93034994-93035016 TTTCCTGGATGTGTTGCTCCTGG + Intergenic
996217733 5:120889831-120889853 TTATCTTTGTGATGTGCTCCTGG + Intergenic
998627543 5:143862661-143862683 TTTACTTTGAGAGTTGCCCTTGG - Intergenic
999808885 5:155109311-155109333 TTTCCTTTCTGGGTTTCTCCAGG + Intergenic
1000132400 5:158312831-158312853 TTTACTTTGTGATTTGCTTTGGG - Intergenic
1000636964 5:163655612-163655634 TTTCTTTTGCCAGGTGCTCCAGG + Intergenic
1001830479 5:174783415-174783437 TTTCCTTTGTGATTTACTTTTGG + Intergenic
1003675576 6:8201505-8201527 TTTCCTTGGCTAGTTGCTGCAGG + Intergenic
1003882223 6:10489201-10489223 TTTCCTCTGTGACATGCTCCTGG + Intergenic
1006877384 6:37309693-37309715 TTTCCTTTGAGAACTGCTCTGGG - Intronic
1007879656 6:45150155-45150177 TTTGATTTATGAGTAGCTCCTGG - Intronic
1008870609 6:56268292-56268314 TTTCCTTTATTAGATGTTCCGGG - Intronic
1009325143 6:62339451-62339473 TTTCTTTTGTTAGGTGTTCCAGG - Intergenic
1009775073 6:68195358-68195380 TTTCCTTTGTTAGATGTTCTGGG - Intergenic
1010304146 6:74298499-74298521 TTTCCTTTTTGGGTAGCTCATGG - Intergenic
1013656634 6:112253777-112253799 TTTCCTTTGTAAGTTGCATTTGG - Intronic
1015946684 6:138509532-138509554 TTTATTTTGTCAGTTTCTCCTGG - Intronic
1017388412 6:153911907-153911929 CTTCCTCTGTCAGCTGCTCCAGG + Intergenic
1018463539 6:164021538-164021560 AATTCTTTGTGAGTTCCTCCTGG - Intergenic
1019465082 7:1183582-1183604 TTTCCATTGTGATTTGCTCCTGG + Intergenic
1021894430 7:25220840-25220862 TTTCCTTTGTGTATTTCTCAAGG + Intergenic
1022966338 7:35476806-35476828 TTTCCTTTGTGATTTCTTCTTGG - Intergenic
1023103183 7:36739574-36739596 ATTCCCAGGTGAGTTGCTCCAGG + Intergenic
1027973724 7:85121107-85121129 TTTCCTTTTTGATGTACTCCGGG - Intronic
1028969270 7:96839128-96839150 TTTCCTTTGTGACTTTCTTATGG + Intergenic
1029055888 7:97742370-97742392 TTTCCTATTTGTGTTGCTACTGG - Intergenic
1032695192 7:134329877-134329899 TTTCCACTGTGAGTTTGTCCTGG + Intergenic
1033428360 7:141265818-141265840 CTTCCTTGGTGAGTTGCTGAAGG + Intronic
1034179555 7:149126715-149126737 TTTCGTTTGTGAGGGGGTCCCGG + Intronic
1035618378 8:1019379-1019401 CTTGCTTTGTGAGTTGCCACGGG - Intergenic
1035957050 8:4092318-4092340 TTTCCTGTGTCTGATGCTCCAGG + Intronic
1036758783 8:11492246-11492268 TTTTCTTTCTGAGTGGCTGCTGG + Intergenic
1038328204 8:26588287-26588309 TGTGCTTTGTGTGTTGCTTCTGG + Intronic
1038404252 8:27310203-27310225 TTTGCCCTGTAAGTTGCTCCTGG + Intronic
1041318021 8:56584027-56584049 TTTCCTTTGTGAGTTTCTTGGGG - Intergenic
1042731871 8:71944370-71944392 ATTCCTTTGTCTGTTTCTCCTGG + Intronic
1042732301 8:71949650-71949672 TTTCCTATGTGATTTCCTTCTGG + Intronic
1043104385 8:76089766-76089788 TTTCTTTTGTGATTGGCTACCGG + Intergenic
1043131771 8:76471898-76471920 TATCCTTTGTGAGTTGATTGTGG + Intergenic
1043424315 8:80133472-80133494 TTTCCTCTTTGTGTTCCTCCTGG + Intronic
1046129833 8:109954020-109954042 TTTCCTTTGTTAGGTGTTCCAGG + Intergenic
1046802548 8:118444389-118444411 TTTCCTTTCTGAATTGGTCCTGG + Intronic
1047524573 8:125621809-125621831 TATCCTCTGTGAGTTCCTCTCGG + Intergenic
1048748379 8:137642303-137642325 TTTCCTTTGTGTGTTTCTATGGG + Intergenic
1049561264 8:143311910-143311932 TATACTTTGTGAGTTGGTTCTGG - Intronic
1050924037 9:11241103-11241125 TTTCCTTTGTTAGGTGCTCTGGG + Intergenic
1052899407 9:33778742-33778764 TTTCTTTTGTTAGGTGTTCCAGG - Intronic
1053642825 9:40105071-40105093 TTTCCATTATGATTTGCTCTTGG + Intergenic
1053763328 9:41360419-41360441 TTTCCATTATGATTTGCTCTTGG - Intergenic
1054323681 9:63702322-63702344 TTTCCATTATGATTTGCTCTTGG + Intergenic
1054541937 9:66271586-66271608 TTTCCATTATGATTTGCTCTTGG - Intergenic
1056667005 9:88589138-88589160 TTTCCTTTGTGTGATGTTCTTGG - Intergenic
1057993561 9:99798491-99798513 ATTACTCTGTGAGTTGCTCAAGG + Intergenic
1059235167 9:112754765-112754787 TTTCATCTGTAAATTGCTCCAGG + Intronic
1059595917 9:115720649-115720671 TTTCCTTTGTGAGGTGCCTCTGG + Intergenic
1059764888 9:117374786-117374808 TTTCCTTTGGTAGGTGCTCCTGG - Intronic
1060301482 9:122376950-122376972 TTTCCTTATAGAGTTTCTCCAGG + Intronic
1061659843 9:132122073-132122095 TTTCCTTGGTGAGGTCATCCTGG - Intergenic
1062296154 9:135828256-135828278 TTGCCTTCTTGAGCTGCTCCTGG - Intronic
1202790576 9_KI270719v1_random:88058-88080 TTTCCATTATGATTTGCTCTTGG + Intergenic
1203367459 Un_KI270442v1:271268-271290 CCTCCTCTGTGAATTGCTCCTGG + Intergenic
1185712046 X:2312336-2312358 TTTTCTTTATTAGTTGCTCTAGG - Intronic
1186878185 X:13838003-13838025 TTTATTTTGTCAGTTTCTCCAGG - Intronic
1186942833 X:14529445-14529467 TTTCCTTTTTCAGTTGCTTGGGG - Intronic
1187726245 X:22205267-22205289 TTTACTTTGTCATTTGCCCCTGG + Intronic
1188187761 X:27136174-27136196 TTTCCTTTATGATTTCCTCTAGG + Intergenic
1190842562 X:54159159-54159181 TTTGTTTTGTGGGTTGCTACAGG - Intronic
1191162648 X:57348055-57348077 TTTCCTATTTTAGGTGCTCCAGG + Intronic
1192631794 X:72782807-72782829 TTTCCTTTGTTTCTTCCTCCTGG + Intronic
1192649915 X:72937994-72938016 TTTCCTTTGTTTCTTCCTCCTGG - Intronic
1193672283 X:84401922-84401944 GTTCCTGTGTTAGTTGCTCAGGG - Intronic
1194100116 X:89693730-89693752 TTTCTTTTGTTAGATGTTCCAGG + Intergenic
1194220805 X:91188032-91188054 TTTTCTTTAGCAGTTGCTCCAGG - Intergenic
1196128426 X:112125331-112125353 TTTCCTTTGTGAGCTGATAACGG - Intergenic
1196457621 X:115901297-115901319 CTTCCTGTATGAGTTGCACCAGG + Intergenic
1197027167 X:121766792-121766814 TTTCATTTGTGAGTAGCTATGGG + Intergenic
1198649443 X:138845611-138845633 TTTTCTTTGTGAATGGCTACTGG - Intronic
1198706001 X:139448478-139448500 CTGCCTGTGTGAGTGGCTCCTGG + Intergenic
1198831117 X:140751813-140751835 ACTCCTTTCTGAGTTGCTGCAGG - Intergenic
1199399102 X:147376361-147376383 TTTCTTTTGTTAGATGTTCCAGG + Intergenic
1199545473 X:149003783-149003805 TTAGTTTTGTGAGTTTCTCCAGG + Intergenic
1199797033 X:151209060-151209082 TTACCTTTTTGATGTGCTCCTGG + Intergenic
1200453116 Y:3355089-3355111 TTTCTTTTGTTAGATGTTCCAGG + Intergenic
1200557311 Y:4651773-4651795 TTTTCTTTAGCAGTTGCTCCAGG - Intergenic