ID: 1158539960

View in Genome Browser
Species Human (GRCh38)
Location 18:58344329-58344351
Sequence TCAAGGGCATTCTTGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158539955_1158539960 3 Left 1158539955 18:58344303-58344325 CCTTTGAACCGTGGGACATTGTG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG 0: 1
1: 0
2: 2
3: 16
4: 146
1158539956_1158539960 -5 Left 1158539956 18:58344311-58344333 CCGTGGGACATTGTGTCTTCAAG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG 0: 1
1: 0
2: 2
3: 16
4: 146
1158539953_1158539960 11 Left 1158539953 18:58344295-58344317 CCTAGAATCCTTTGAACCGTGGG 0: 1
1: 0
2: 2
3: 11
4: 79
Right 1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG 0: 1
1: 0
2: 2
3: 16
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158539960 Original CRISPR TCAAGGGCATTCTTGGCATT TGG Intronic
905781684 1:40716330-40716352 ACAAGGGCATTCCAGACATTGGG + Intronic
906471617 1:46135503-46135525 TGAAGGGCATCCTAGCCATTTGG - Intronic
907278508 1:53329785-53329807 GGAAGGGCATTCTTGGCAAAGGG + Intergenic
908498530 1:64719721-64719743 TGAATGGCATTCTTGGATTTTGG - Intergenic
910857735 1:91712610-91712632 TGAAGGGCTGTCTTGGCATATGG - Intronic
911393421 1:97275074-97275096 GCAAGAGCAACCTTGGCATTAGG + Intronic
912178822 1:107193038-107193060 TCAAGGGCATTTATTTCATTAGG - Intronic
912388140 1:109282908-109282930 TCCAGGGCAATCTGGGCAGTTGG - Intronic
915495778 1:156281999-156282021 TCCAGAGCGTTCTTGGGATTTGG - Intronic
918226739 1:182490809-182490831 TAAAGGGCCTTCTTTGCATTTGG + Intronic
923828806 1:237530422-237530444 TCCAGGACTTTGTTGGCATTAGG + Exonic
924351838 1:243122082-243122104 ACAAAGACATTCTTAGCATTTGG + Intergenic
1066188034 10:33029719-33029741 TCAAGGTAATTCTGGGCATTAGG - Intergenic
1066445771 10:35481361-35481383 TCCAGGACATTCTTGGACTTAGG + Intronic
1071679050 10:87685970-87685992 TCCAGTGCATTATTGGCCTTTGG + Intronic
1072987529 10:100154485-100154507 TCAAAGGCATTCCTGGCATTTGG - Intronic
1075862625 10:125690353-125690375 TCCAGGGCATTTTTGCCAATGGG + Intergenic
1076501106 10:130936694-130936716 ACAAGGCCATTCTTGGCAGGTGG - Intergenic
1077716321 11:4584370-4584392 TCTAGTCCATTCTTGGCATCTGG + Intergenic
1078944230 11:16045701-16045723 GCAGGGGCATTCTAGGCACTAGG - Intronic
1079771134 11:24461236-24461258 TAGAGGACATTCTTGGCAGTGGG + Intergenic
1084380776 11:68811296-68811318 CCAATGGCATTTTTGCCATTTGG - Intronic
1096095456 12:48932618-48932640 TAAAGGGCACTCTTGGCCTTAGG - Intronic
1097685729 12:62689196-62689218 GAAAGGGCATTCTTGGCAAAAGG + Intronic
1099928873 12:89050924-89050946 TCAATGACATTATTGACATTGGG - Intergenic
1100714525 12:97291827-97291849 ACAGGGGTACTCTTGGCATTTGG - Intergenic
1106405558 13:29470045-29470067 TGAAGGGCATTTTGGGCATTAGG - Intronic
1107083394 13:36398889-36398911 TCAAGGGCATTCCAGGCAGAAGG - Intergenic
1108486639 13:50933428-50933450 TAAAGGGCATTTTTGGCACTTGG - Intronic
1110540253 13:76699901-76699923 ATATGGGAATTCTTGGCATTTGG - Intergenic
1110616176 13:77544576-77544598 CTCAGGGAATTCTTGGCATTGGG + Intronic
1111616992 13:90672290-90672312 TCATGAGCATTCTCGGAATTAGG - Intergenic
1115234637 14:31196916-31196938 CCATGGGCATTTTAGGCATTAGG + Intronic
1118443826 14:65834618-65834640 CCAAGTGCATTCTTAGCAATGGG + Intergenic
1123155175 14:106218016-106218038 TAAAGGGCATGCTGGGCACTGGG - Intergenic
1123181704 14:106477417-106477439 TAAAGTGCATGCTGGGCATTGGG - Intergenic
1202945200 14_KI270726v1_random:19311-19333 TAAAGTGCATGCTGGGCATTGGG + Intergenic
1128296544 15:66525594-66525616 ACAGGGGCACTATTGGCATTTGG + Intronic
1128914360 15:71546412-71546434 TCAAGTGCATTGTAGGCTTTAGG + Intronic
1129856528 15:78829168-78829190 TGAAGGGCATTCTTGGCAGAGGG + Intronic
1131681126 15:94725037-94725059 TCAAGGGCATGGTTGGCCTCAGG + Intergenic
1134421196 16:14091496-14091518 CCAGGGGCACTCTTGGCCTTGGG + Intronic
1138464490 16:57178214-57178236 GCAAGGGCATTCCTGGCAGAGGG - Intronic
1138671347 16:58617631-58617653 ACAAGGGCACTGTTGGCATTTGG - Intronic
1140241280 16:73203168-73203190 TCAAGGCCATTCCAGGCATATGG - Intergenic
1141025021 16:80538446-80538468 TCTTTGGCATTCTTGGCAGTTGG - Intergenic
1141515537 16:84542338-84542360 TCTAGGACATTCTAGGCTTTTGG - Intronic
1142513828 17:413948-413970 TCAGGGGCCTCCTCGGCATTGGG - Exonic
1142858041 17:2743667-2743689 TGAAGGGCATTCCTGGCAGAGGG - Intergenic
1143327156 17:6106858-6106880 TGAAGGGCATTCCTGGCAGGGGG + Intronic
1145789772 17:27619118-27619140 TCAGGGGCTTTCTTGGCAGCGGG - Intronic
1150379080 17:64706594-64706616 GCAAGGGCATTCTAGGCAGTGGG - Intergenic
1150588342 17:66538722-66538744 TGATGGGCATTAGTGGCATTTGG + Intronic
1151518441 17:74612395-74612417 TCCAGGGAATTCTTGCCCTTGGG + Exonic
1155320831 18:24617336-24617358 CCAAGTGCCTTCTGGGCATTAGG + Intergenic
1156241419 18:35258226-35258248 TCAAGGCCATTCATGGCCATGGG + Intronic
1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG + Intronic
1160068648 18:75604507-75604529 TCTAGGGCTTTTTTGGCTTTAGG - Intergenic
1160266236 18:77342545-77342567 TCAGGGGCGTCCTTGGCAGTAGG + Intergenic
1165908877 19:39211673-39211695 TCAAGTTCAGTCTGGGCATTTGG - Intergenic
925386565 2:3466138-3466160 TCAAGGACATTCTTAGCAAAGGG - Intronic
925979183 2:9163604-9163626 CCTGGGGCATTTTTGGCATTAGG + Intergenic
926467542 2:13209546-13209568 TCAAAGCCATTCTTGGTCTTTGG - Intergenic
926576957 2:14593222-14593244 TCAAGCACATTTTTGACATTGGG + Intergenic
928326202 2:30321597-30321619 TTAAGTGCATTCTAGGCACTGGG + Intronic
930212986 2:48662527-48662549 TCAAGGGGATCCATGGCAATAGG + Intronic
933067120 2:77811385-77811407 TCTAGGGCTTTTTTGGTATTAGG - Intergenic
934928214 2:98396944-98396966 TCCAGGGCCTTCTTGGCTTCGGG - Exonic
937017606 2:118619996-118620018 AGAAGGGCATTCTTGGCAAAGGG - Intergenic
938226830 2:129623979-129624001 TCAAGGGCATTCCTGGAATGTGG + Intergenic
941646530 2:168046871-168046893 TTAATGGCATCTTTGGCATTAGG - Intronic
942674946 2:178416763-178416785 TCACGGGCATTTCTGGGATTTGG + Intergenic
945423304 2:209665637-209665659 TAAAGGGCATTGGTGACATTTGG - Intronic
946653405 2:221918520-221918542 GCAAGGAAATTCTTGGAATTGGG + Intergenic
947346071 2:229190390-229190412 CCAATGGAATTCCTGGCATTTGG + Intronic
949017082 2:241719607-241719629 TCAAGGGTATGCTAGGCATAAGG + Intronic
1169896861 20:10513610-10513632 GCAAGGGCATCCTTGGATTTAGG + Intronic
1170058031 20:12228682-12228704 TATAGGCCATTCTTGGCTTTGGG + Intergenic
1171511202 20:25686106-25686128 TTACAGGCTTTCTTGGCATTTGG - Exonic
1172651018 20:36501482-36501504 TCAAGGGAATTTTTGGAAATTGG - Intronic
1173564737 20:44030574-44030596 TCAAGGGCACACTGGGCATCAGG - Intronic
1176638681 21:9275055-9275077 GCAATGGCAGTTTTGGCATTTGG + Intergenic
1179019195 21:37622945-37622967 TGAAGGGCACTCTTGGCTTGGGG - Exonic
1181620300 22:24086475-24086497 TCAAGTGCTTTCCTGGCACTGGG - Intronic
949486172 3:4541240-4541262 TCAAGCACATTCTTAGAATTTGG + Intronic
950842569 3:15981570-15981592 TCCAGGGCATTCTAGACATGGGG - Intergenic
951271840 3:20634705-20634727 TCATGGGCATTTTTTGGATTCGG + Intergenic
952213913 3:31256572-31256594 TCAATAGCATTCTTTGCTTTAGG - Intergenic
954753523 3:52826882-52826904 TCAAAGGTGATCTTGGCATTGGG + Exonic
955250941 3:57281564-57281586 TCTAAGGCATTCTTGGAATGGGG - Intronic
955628449 3:60946309-60946331 ACAAGGGCACTATTGGCATTTGG + Intronic
956731856 3:72203796-72203818 TCCTGGGCATTCTTGCCATCTGG - Intergenic
957743651 3:84308214-84308236 TCAAAAGCATACTAGGCATTTGG + Intergenic
960324163 3:116274746-116274768 TCAAGGGCAATCTAGGCAAAAGG + Intronic
961975690 3:131022747-131022769 GCAAGAGCCTTCTTGGCATTGGG - Intronic
962643395 3:137411944-137411966 ACAAGGGAATTCTTGGTACTAGG + Intergenic
963672083 3:148263469-148263491 TCTGGGGCATTCTAGGGATTTGG + Intergenic
966119613 3:176507450-176507472 ACAAGGGCATCCTTGGGATAAGG + Intergenic
967694637 3:192515851-192515873 AAAAGGGCATTGTTGGCATCAGG - Intronic
967903078 3:194477120-194477142 AGAAGGGCATTCTTGGCAGAAGG - Intronic
968291380 3:197542306-197542328 TCATGGGCATTCTTAGCCCTGGG - Intronic
969522108 4:7684414-7684436 GAAAGGGCATTCTAGGCCTTGGG - Intronic
970995516 4:22263082-22263104 TCAAGGGTATTATTGGCAGGAGG + Intergenic
972423970 4:38915441-38915463 TCAAGTGCTTTGTTTGCATTGGG - Intronic
974033323 4:56795753-56795775 TCATGGGGATTCTTGGAACTTGG - Intergenic
975367501 4:73545668-73545690 TCAAGGTTATTCCTTGCATTGGG - Intergenic
975848773 4:78551071-78551093 GGAAGGGCATTCTAGGCATTTGG - Intergenic
977310287 4:95377801-95377823 TCAAGGTCATTCTGTGGATTTGG + Intronic
979250100 4:118558440-118558462 ACAAAGACATTCTTAGCATTTGG - Intergenic
979466938 4:121050742-121050764 TCAAAGGCCTTCTTCACATTTGG + Intronic
981224884 4:142282654-142282676 TCAAGGCCATTCTTGCCATAAGG + Intronic
982324553 4:154116421-154116443 ACAAGGGGATGCTTGGGATTGGG + Intergenic
982452675 4:155571591-155571613 TCAAGGGCAGTATTTGAATTTGG - Intergenic
982564079 4:156967399-156967421 TCAAGGGCTTTTGTGGCATGTGG - Intronic
985297635 4:188452571-188452593 TCAAGGGCATTCTAATCAATTGG - Intergenic
992767897 5:80019343-80019365 TGAAGGGCATGCCTTGCATTGGG - Intronic
994131728 5:96236608-96236630 TCACGTGCATTTTGGGCATTTGG - Intergenic
998188095 5:139998370-139998392 TCCAGGACTTTCTTGGCCTTGGG - Intronic
998484379 5:142488926-142488948 CCAAGAGCATTCTTAGCCTTAGG - Intergenic
998517955 5:142772345-142772367 TCAAGGCCATTCTTGGTTTAGGG + Intronic
999470691 5:151852259-151852281 ACAAGGGCATTCTGGGCAAAGGG - Intronic
1000049282 5:157548043-157548065 TCAATGTCATTCTTGCCTTTGGG + Intronic
1000413030 5:160954071-160954093 TCATGGGCTTTTTGGGCATTAGG + Intergenic
1008817410 6:55585066-55585088 TTAAAAACATTCTTGGCATTTGG + Intergenic
1011544734 6:88470691-88470713 TCAAGGCATTTCTTGGCTTTCGG - Intergenic
1017269407 6:152489366-152489388 TAAATGGCATTCTTTCCATTCGG - Intronic
1020580640 7:9995664-9995686 TCAGGCGCATTCTTGGCATTAGG - Intergenic
1023463483 7:40427009-40427031 TCAAGACCATTCTGGGCAATAGG - Intronic
1023779256 7:43640850-43640872 TCAATGGCAGTCTTTCCATTTGG + Intronic
1028563396 7:92200854-92200876 TAAAGGACATTCATGACATTGGG + Intronic
1032090960 7:128911396-128911418 TGAAGGGCGGCCTTGGCATTTGG - Intergenic
1033454544 7:141490814-141490836 TAAAGGGCTTTCTTGGCATGAGG - Intergenic
1033826267 7:145193758-145193780 TCAAGGTGTTTGTTGGCATTGGG - Intergenic
1036495162 8:9263608-9263630 ACAGAGGCATTCTTGGCAATGGG + Intergenic
1039036751 8:33368032-33368054 CCAAGGGCATTTTGAGCATTAGG - Intergenic
1040732163 8:50461416-50461438 TCAACTGCATAATTGGCATTGGG - Intronic
1041484327 8:58357798-58357820 TTCCTGGCATTCTTGGCATTCGG + Intergenic
1044738771 8:95304569-95304591 TGAAGAGCCCTCTTGGCATTAGG + Intergenic
1045716202 8:105048636-105048658 TGAAGGGCAATCTTGGCAAAGGG - Intronic
1049466579 8:142753703-142753725 GGAAGGGCATTCCTGGCAGTGGG - Intergenic
1050560422 9:6829258-6829280 TCCAGGGCATTATGGACATTAGG + Intronic
1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG + Intronic
1057083064 9:92187277-92187299 TCAAGGACTTTCCTGGCACTAGG - Intergenic
1061127017 9:128683642-128683664 GCAGGGGCACTCTTGGCTTTGGG - Exonic
1061731398 9:132617176-132617198 GGAAGGGCATTCTGGGCAGTGGG - Intronic
1186657739 X:11633320-11633342 GCAAAGGCATTCATGGCACTGGG - Intronic
1186747131 X:12581782-12581804 AGAAGGGCATTCTTGGCAGAGGG - Intronic
1189248404 X:39581067-39581089 TCACAGCCATCCTTGGCATTGGG - Intergenic
1190336972 X:49268685-49268707 TCAGGGGCATTCTTGGCTTGTGG + Intergenic
1197151347 X:123223211-123223233 TCAAGGACATTCTTGACAAAGGG - Intronic
1197318003 X:124992220-124992242 TCCAGGACAGTCTTGGCAGTGGG - Intergenic
1197371719 X:125635153-125635175 TCAACAGCATTTTAGGCATTGGG + Intergenic
1199657403 X:150010150-150010172 ACAAGGGCAAACTTGGCCTTTGG - Intergenic
1199853878 X:151744193-151744215 TCTAGGACTTTCTTGGCATCAGG - Exonic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1201695084 Y:16816027-16816049 TCAAGGCCACTCTCAGCATTAGG - Intergenic