ID: 1158542639

View in Genome Browser
Species Human (GRCh38)
Location 18:58370569-58370591
Sequence TTGCATTCCATGTGAACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158542638_1158542639 -8 Left 1158542638 18:58370554-58370576 CCACTTTTATGGGTGTTGCATTC 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1158542639 18:58370569-58370591 TTGCATTCCATGTGAACAACAGG 0: 1
1: 0
2: 1
3: 7
4: 136
1158542635_1158542639 10 Left 1158542635 18:58370536-58370558 CCATATTTGTAGTCTCAGCCACT 0: 1
1: 0
2: 6
3: 55
4: 485
Right 1158542639 18:58370569-58370591 TTGCATTCCATGTGAACAACAGG 0: 1
1: 0
2: 1
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158542639 Original CRISPR TTGCATTCCATGTGAACAAC AGG Intronic
901847133 1:11990615-11990637 TTCCCTTCCATTTAAACAACAGG - Intronic
906087062 1:43144954-43144976 TTGCATTCCGTGTGTCCACCAGG - Intergenic
907795253 1:57709737-57709759 TTGCATAGCATGTGAAAATCTGG + Intronic
908048661 1:60202418-60202440 TTGAATTCCATGTGAATAGAGGG - Intergenic
908571429 1:65415116-65415138 TTGCATTCCTTTTAAATAACTGG + Exonic
915699813 1:157781181-157781203 CTGGGTTCCATGAGAACAACAGG + Intergenic
918540189 1:185623753-185623775 TTGCATAACATGTGAAAAACTGG + Intergenic
919183657 1:194117674-194117696 TTGCACTCCAGGTGAATACCAGG - Intergenic
919314646 1:195955428-195955450 TTGCTTTACATTTGCACAACTGG + Intergenic
919432523 1:197514115-197514137 TAGCATTCCATGATAACGACTGG + Intronic
920782549 1:209008349-209008371 TTTCATTCCCTGAGAACAATGGG - Intergenic
921984208 1:221292893-221292915 TTGCATAGCGTGTGAAGAACTGG - Intergenic
924001368 1:239556473-239556495 TTGCTTTCCATGTGAAGTAGTGG - Intronic
924470772 1:244340710-244340732 TTGCATCCCACGTGGCCAACCGG + Intergenic
924517836 1:244781024-244781046 TTGCATGTCATGTCACCAACGGG - Intergenic
1066707751 10:38200158-38200180 TTTCATTCCAAGTGCACAGCAGG - Intergenic
1068243372 10:54334926-54334948 TTATATTCAATGTGAACAAATGG - Intronic
1069543674 10:69314210-69314232 TAGCTTTCCATGGGAACATCTGG - Intronic
1071073287 10:81720546-81720568 TTGTTTTCCAAGTGAACAATTGG + Intergenic
1071309750 10:84331258-84331280 TTGCACTCCCTCTGAAAAACTGG - Intronic
1071758232 10:88570573-88570595 TTGCATTGCATGTAATCAATGGG - Intronic
1075272238 10:121062326-121062348 TTGCATTCGAGGGGAAAAACAGG + Intergenic
1075577406 10:123587770-123587792 GAGCAGTCCATGTGAACAGCTGG - Intergenic
1077592512 11:3503540-3503562 TTACATTCCATGTCCACAATGGG - Intergenic
1081171392 11:39874016-39874038 TTGCATTCCAAATGTGCAACTGG - Intergenic
1084248347 11:67876263-67876285 TTACATTCCATGTCCACAATGGG - Intergenic
1084824474 11:71719218-71719240 TTACATTCCATGTCCACAATGGG + Intergenic
1089865893 11:121631288-121631310 CTGTATTTCATGTTAACAACTGG + Exonic
1092719861 12:11431178-11431200 ATGCATTCCATGAGAAGGACTGG + Intronic
1100603387 12:96131389-96131411 TTGCATAGCATGGGAAGAACTGG + Intergenic
1100796412 12:98186320-98186342 TAGCCTTCCATGTGGTCAACGGG - Intergenic
1107952751 13:45479001-45479023 TTGCAAACCATGAGAAAAACTGG - Exonic
1108711009 13:53032319-53032341 TTGCATTGCATTTTAACAAGGGG - Intronic
1112823600 13:103365466-103365488 GTGCATTAGATGTGAACAACTGG + Intergenic
1114954465 14:27800195-27800217 ATGCATTCCATGAAAAGAACAGG - Intergenic
1115024843 14:28731763-28731785 TTACATTCCATGGGAACTGCTGG + Intergenic
1115152920 14:30306020-30306042 TAGCATTGCACGTGAAAAACTGG + Intergenic
1118017663 14:61676258-61676280 TTGCATTTCATGAGAACACATGG - Intergenic
1118934650 14:70275923-70275945 TTACATTCAATGTGAAAAAATGG - Intergenic
1119462400 14:74818323-74818345 TTGCATTGCATTTGAACCAAAGG - Intronic
1120090519 14:80327247-80327269 TTGCCATCTATGTGAACAATAGG + Intronic
1123890564 15:24774279-24774301 GTGCCTTCCATTTGAAGAACCGG + Intergenic
1124192229 15:27590253-27590275 TTGCCTTCCATGTGAAGCAGAGG + Intergenic
1126173140 15:45710933-45710955 TGTCATTCCATGTAAACAATAGG + Intergenic
1127472803 15:59305639-59305661 TTTCCTCCCATCTGAACAACTGG + Intronic
1134129106 16:11636476-11636498 TTGCATAGCACGTGAAGAACTGG + Intergenic
1142660095 17:1422830-1422852 TTTCATTCCAGGTGAAAAGCAGG - Exonic
1147182151 17:38693222-38693244 TTGAATGCCATGAGAACATCTGG + Intergenic
1151090707 17:71437137-71437159 TTACATTTCTTGTGAACAACTGG + Intergenic
1152910504 17:83002739-83002761 CTGCATGCGATGTGGACAACAGG - Intronic
1153362224 18:4210106-4210128 GAGCATTCCATGGGAACAAATGG - Intronic
1156955869 18:42963150-42963172 TTGCATTTCATCTGAAAATCAGG - Intronic
1157943935 18:51957917-51957939 TTGCATTCCAATTGAAGAAAAGG + Intergenic
1158542639 18:58370569-58370591 TTGCATTCCATGTGAACAACAGG + Intronic
1159362264 18:67420428-67420450 TCGCATTCCATGTGAGAAAATGG - Intergenic
1160236983 18:77093481-77093503 TTGCATTCCAACTTAACAAAGGG + Intronic
1162880174 19:13653007-13653029 TTGCATAGCATGTGAAGACCCGG - Intergenic
930351426 2:50260483-50260505 TTGTATTCCAATAGAACAACAGG - Intronic
931078373 2:58741712-58741734 TTGCATTCCAGCTGGGCAACAGG + Intergenic
934482846 2:94669095-94669117 ATGCATTCCATGAAAAGAACAGG + Intergenic
936703116 2:115037824-115037846 TTGAAGTACATGTGAACCACTGG - Intronic
936813827 2:116435191-116435213 TTACATTACATGTCAAAAACAGG + Intergenic
940533919 2:154914252-154914274 TTGCACTGCTTGTGAATAACAGG + Intergenic
940990343 2:160089526-160089548 TTGCATAGCATGTGAAAATCTGG + Intergenic
944145086 2:196498895-196498917 TTGCATTCCAACAGACCAACTGG + Intronic
946703696 2:222437299-222437321 TTCCATTCAAAGTGCACAACTGG + Intronic
1173469173 20:43309379-43309401 TTGGATTCCAGGTGGACCACTGG - Intergenic
1174939962 20:54915719-54915741 TGGCATTCCATGTCAGAAACTGG - Intergenic
1180121948 21:45758304-45758326 TTGCATTCCATGTGAATTTTAGG + Intronic
1180626210 22:17195135-17195157 TTATATTCCATTTTAACAACTGG - Intronic
1181117186 22:20639492-20639514 TTGCCTTCCTTGTGAAGAAAAGG - Intergenic
1184568193 22:45306035-45306057 CTGCATTCCAAGGGACCAACAGG - Intergenic
952157682 3:30660944-30660966 TGGCTTTCCAGGTGAACCACAGG - Intronic
957062585 3:75494107-75494129 TTACATTCCATGTCCACAATGGG - Intergenic
958012160 3:87893690-87893712 TTGCAATCCATGACAATAACTGG + Intergenic
959480407 3:106865482-106865504 AAGCTTTCCATGTGAAGAACAGG + Intergenic
960845940 3:122004842-122004864 TTTCCTTCCATGTGAACAACAGG + Intronic
960974132 3:123158993-123159015 TTGCATTCCATGTGTGCGGCTGG + Intronic
961290814 3:125845309-125845331 TTACATTCCATGTCCACAATGGG + Intergenic
961776368 3:129289118-129289140 TAGCATTCCACATTAACAACTGG - Intronic
961896307 3:130170886-130170908 TTACATTCCATGTCCACAATGGG - Intergenic
967720539 3:192811424-192811446 TTACATTTCATATGGACAACTGG + Intronic
968033991 3:195529727-195529749 TTGCATTTCATATGAACGTCTGG - Intronic
968247313 3:197165159-197165181 GTGTATTCCTTGTCAACAACTGG - Intronic
969006482 4:4024230-4024252 TTACATTCCATGTCCACAATGGG - Intergenic
969671023 4:8590484-8590506 TTGTATCCCATGTGAACAGGAGG - Intronic
969806480 4:9613072-9613094 TTACATTCCATGTCCACAATGGG + Intergenic
973303541 4:48617260-48617282 TTTCAGTCCATGTGAACCATGGG + Intronic
974340292 4:60605844-60605866 TTGCATTCCATCTGTAGCACAGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
976305411 4:83554766-83554788 TTCCATTCCATGTGTAGAAGAGG - Intronic
978375896 4:108075297-108075319 TTCCAGTCCATGTGAACAGGAGG - Intronic
981580085 4:146242331-146242353 CTGCATCCCATGTGGACAAAGGG - Intergenic
981841724 4:149120763-149120785 TTGTCTTCCATGTGAACAAGGGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
986425491 5:7627135-7627157 TTTCATCCTATGTGGACAACAGG - Intronic
988525868 5:31986669-31986691 TTTCATTCCATTTGAATAATGGG + Intronic
989534948 5:42552423-42552445 TTGCTTTCCATCTTAACATCAGG - Intronic
990086426 5:51983734-51983756 TTGCATTCCAAGTTCTCAACTGG + Intergenic
992736685 5:79728770-79728792 TTGCCTTCCATGTCAAAAAGAGG - Intronic
992766779 5:80008335-80008357 TTGAATTTCATATGAATAACAGG + Intronic
993988801 5:94630605-94630627 TTGCATTTGAGGTGAATAACGGG - Exonic
994003670 5:94812140-94812162 TTGCATTCTATTTAAACAAAAGG + Intronic
994559831 5:101353584-101353606 TTGCATGCAATGTGCCCAACAGG - Intergenic
1007307706 6:40919708-40919730 TTACATTTCATGTTAATAACTGG - Intergenic
1012441975 6:99269288-99269310 TCTCATGCCAAGTGAACAACAGG - Intergenic
1014287128 6:119513087-119513109 ATGCATTCCATCTGATCACCTGG + Intergenic
1018530459 6:164757655-164757677 GTCCATTCCATGTGCACAAAAGG - Intergenic
1020327018 7:6982522-6982544 TTACATTCCATGTCCACAATGGG - Intergenic
1023274271 7:38501129-38501151 TTGCATGCCAAGGAAACAACAGG - Intronic
1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG + Intergenic
1029067174 7:97862152-97862174 TTGCATTGCATGCAAACAAATGG + Intronic
1029291602 7:99505687-99505709 TTACATTCCATATAAATAACGGG - Intronic
1032800594 7:135314510-135314532 TTGCCTTCCCTGAGAACAGCTGG + Intergenic
1036369618 8:8151565-8151587 TTACATTCCATGTCCACAATGGG + Intergenic
1036881271 8:12514079-12514101 TTACATTCCATGTCCACAATGGG - Intergenic
1037103633 8:15078427-15078449 TTGCCTTTCTTGTGAAAAACTGG + Intronic
1038260541 8:25989706-25989728 GTGTATTCCATGTAAATAACAGG + Intronic
1038364917 8:26921466-26921488 TTCCAGTCAATGTGAACTACAGG - Intergenic
1038922115 8:32096141-32096163 TTGCATTGTATTTGAACACCAGG + Intronic
1039009422 8:33076185-33076207 TTCCCTTCCCTGTAAACAACTGG + Intergenic
1040762854 8:50872085-50872107 TTGCATTCTATGTGTATAACGGG - Intergenic
1042388743 8:68208008-68208030 TTGTATTTCATGTGAAGAAATGG + Intronic
1042793194 8:72631750-72631772 TTTCATTCCTTTTGAAAAACAGG + Intronic
1044186317 8:89255778-89255800 TTGTAATCCAGGTGAACAGCAGG - Intergenic
1047177134 8:122552702-122552724 TTGCAATCCTAGTGGACAACTGG - Intergenic
1047889962 8:129296779-129296801 TTCCATTAAATGTGAACAATGGG + Intergenic
1051569855 9:18543524-18543546 CAGCATGCCATGTGGACAACTGG + Intronic
1051904374 9:22078504-22078526 TTGCATTCAATTTGAACAAGAGG + Intergenic
1053674983 9:40415625-40415647 ATGCATTCCATGAAAAGAACAGG - Intergenic
1053924776 9:43041984-43042006 ATGCATTCCATGAAAAGAACAGG - Intergenic
1054288260 9:63254157-63254179 ATGCATTCCATGAAAAGAACAGG - Intergenic
1054386086 9:64555692-64555714 ATGCATTCCATGAAAAGAACAGG - Intergenic
1054509636 9:65960668-65960690 ATGCATTCCATGAAAAGAACAGG + Intergenic
1056107187 9:83358779-83358801 GTGCATGGCATGTGCACAACAGG - Intronic
1056677889 9:88691746-88691768 TTGCTTTGCATGTGAGCACCAGG - Intergenic
1057562663 9:96140374-96140396 TTCCATCCCATATGCACAACAGG - Intergenic
1060070219 9:120540583-120540605 TGGAATTCAATGTGAACAACTGG + Intronic
1060424245 9:123491667-123491689 TTGAAGTCCGTGAGAACAACTGG - Intronic
1186946530 X:14574917-14574939 TTCCATTACATGTAAAAAACTGG - Intronic
1187088541 X:16068260-16068282 TTGCCTTCTATGTGAATAGCAGG + Intergenic
1187242754 X:17528477-17528499 TTGAGTTACATGTGAATAACTGG + Intronic
1194227453 X:91279020-91279042 TTGGGTTCCATGAGAAAAACAGG + Intergenic
1196276452 X:113771239-113771261 TTGCATTACAGCTGAAGAACAGG + Intergenic
1198603892 X:138315024-138315046 TTATTTTCCATGTGAACCACTGG + Intergenic