ID: 1158546762

View in Genome Browser
Species Human (GRCh38)
Location 18:58404060-58404082
Sequence GCCCTCCAGGCCCACAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158546762_1158546769 16 Left 1158546762 18:58404060-58404082 CCAGTACTGTGGGCCTGGAGGGC No data
Right 1158546769 18:58404099-58404121 TTGTGGCCTTGGACTCTGCTGGG No data
1158546762_1158546767 5 Left 1158546762 18:58404060-58404082 CCAGTACTGTGGGCCTGGAGGGC No data
Right 1158546767 18:58404088-58404110 TTTGTTGTCATTTGTGGCCTTGG No data
1158546762_1158546768 15 Left 1158546762 18:58404060-58404082 CCAGTACTGTGGGCCTGGAGGGC No data
Right 1158546768 18:58404098-58404120 TTTGTGGCCTTGGACTCTGCTGG No data
1158546762_1158546770 17 Left 1158546762 18:58404060-58404082 CCAGTACTGTGGGCCTGGAGGGC No data
Right 1158546770 18:58404100-58404122 TGTGGCCTTGGACTCTGCTGGGG No data
1158546762_1158546766 -1 Left 1158546762 18:58404060-58404082 CCAGTACTGTGGGCCTGGAGGGC No data
Right 1158546766 18:58404082-58404104 CCAGGTTTTGTTGTCATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158546762 Original CRISPR GCCCTCCAGGCCCACAGTAC TGG (reversed) Intergenic
No off target data available for this crispr