ID: 1158547117

View in Genome Browser
Species Human (GRCh38)
Location 18:58405825-58405847
Sequence CCGTGGGAGGCTCTGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158547117_1158547132 18 Left 1158547117 18:58405825-58405847 CCACCTGCCAGAGCCTCCCACGG No data
Right 1158547132 18:58405866-58405888 GGCACTCAAAAGAAAAGGGAAGG No data
1158547117_1158547128 -3 Left 1158547117 18:58405825-58405847 CCACCTGCCAGAGCCTCCCACGG No data
Right 1158547128 18:58405845-58405867 CGGGGCTGGGAAATACCTAGTGG No data
1158547117_1158547130 13 Left 1158547117 18:58405825-58405847 CCACCTGCCAGAGCCTCCCACGG No data
Right 1158547130 18:58405861-58405883 CTAGTGGCACTCAAAAGAAAAGG No data
1158547117_1158547134 25 Left 1158547117 18:58405825-58405847 CCACCTGCCAGAGCCTCCCACGG No data
Right 1158547134 18:58405873-58405895 AAAAGAAAAGGGAAGGAAATGGG No data
1158547117_1158547133 24 Left 1158547117 18:58405825-58405847 CCACCTGCCAGAGCCTCCCACGG No data
Right 1158547133 18:58405872-58405894 CAAAAGAAAAGGGAAGGAAATGG No data
1158547117_1158547131 14 Left 1158547117 18:58405825-58405847 CCACCTGCCAGAGCCTCCCACGG No data
Right 1158547131 18:58405862-58405884 TAGTGGCACTCAAAAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158547117 Original CRISPR CCGTGGGAGGCTCTGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr