ID: 1158547732

View in Genome Browser
Species Human (GRCh38)
Location 18:58410313-58410335
Sequence CTGTAAACTCAGAGGAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158547732_1158547739 19 Left 1158547732 18:58410313-58410335 CCAACCCTCCTCTGAGTTTACAG No data
Right 1158547739 18:58410355-58410377 TCTTATTGTGGTTATTAGTATGG No data
1158547732_1158547736 7 Left 1158547732 18:58410313-58410335 CCAACCCTCCTCTGAGTTTACAG No data
Right 1158547736 18:58410343-58410365 TCCCTTTCTGTCTCTTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158547732 Original CRISPR CTGTAAACTCAGAGGAGGGT TGG (reversed) Intergenic
No off target data available for this crispr