ID: 1158548849

View in Genome Browser
Species Human (GRCh38)
Location 18:58417820-58417842
Sequence CCACCCAGGCAGGTTTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158548849_1158548857 25 Left 1158548849 18:58417820-58417842 CCCACAGAAACCTGCCTGGGTGG No data
Right 1158548857 18:58417868-58417890 TCCTCTTAAGTTATTTGCAGAGG No data
1158548849_1158548855 -6 Left 1158548849 18:58417820-58417842 CCCACAGAAACCTGCCTGGGTGG No data
Right 1158548855 18:58417837-58417859 GGGTGGTTGATGCATAAGGAAGG No data
1158548849_1158548853 -10 Left 1158548849 18:58417820-58417842 CCCACAGAAACCTGCCTGGGTGG No data
Right 1158548853 18:58417833-58417855 GCCTGGGTGGTTGATGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158548849 Original CRISPR CCACCCAGGCAGGTTTCTGT GGG (reversed) Intergenic
No off target data available for this crispr