ID: 1158550049

View in Genome Browser
Species Human (GRCh38)
Location 18:58428245-58428267
Sequence CACTACTGCATTCCAGCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158550047_1158550049 10 Left 1158550047 18:58428212-58428234 CCAGGAGTTAGAGATTACAGTGA No data
Right 1158550049 18:58428245-58428267 CACTACTGCATTCCAGCCTAGGG No data
1158550046_1158550049 11 Left 1158550046 18:58428211-58428233 CCCAGGAGTTAGAGATTACAGTG No data
Right 1158550049 18:58428245-58428267 CACTACTGCATTCCAGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158550049 Original CRISPR CACTACTGCATTCCAGCCTA GGG Intergenic
No off target data available for this crispr