ID: 1158551810

View in Genome Browser
Species Human (GRCh38)
Location 18:58442560-58442582
Sequence CAGTGGGGCTGGAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158551810_1158551820 2 Left 1158551810 18:58442560-58442582 CCAGCTTCCTTCCAGCCCCACTG No data
Right 1158551820 18:58442585-58442607 CTTGGCATGGTCCCTGCACATGG No data
1158551810_1158551821 11 Left 1158551810 18:58442560-58442582 CCAGCTTCCTTCCAGCCCCACTG No data
Right 1158551821 18:58442594-58442616 GTCCCTGCACATGGCAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158551810 Original CRISPR CAGTGGGGCTGGAAGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr