ID: 1158555340

View in Genome Browser
Species Human (GRCh38)
Location 18:58470352-58470374
Sequence TCTGAAGTCCACCACTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158555334_1158555340 4 Left 1158555334 18:58470325-58470347 CCCGTGCGAGGCAGTTTTTCTTC No data
Right 1158555340 18:58470352-58470374 TCTGAAGTCCACCACTGGGAGGG No data
1158555335_1158555340 3 Left 1158555335 18:58470326-58470348 CCGTGCGAGGCAGTTTTTCTTCC No data
Right 1158555340 18:58470352-58470374 TCTGAAGTCCACCACTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158555340 Original CRISPR TCTGAAGTCCACCACTGGGA GGG Intergenic
No off target data available for this crispr