ID: 1158556246

View in Genome Browser
Species Human (GRCh38)
Location 18:58477124-58477146
Sequence GCTCCATGGTTGAGCCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158556242_1158556246 -9 Left 1158556242 18:58477110-58477132 CCACCCGTCAGGGAGCTCCATGG 0: 1
1: 0
2: 0
3: 6
4: 171
Right 1158556246 18:58477124-58477146 GCTCCATGGTTGAGCCCTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 85
1158556237_1158556246 26 Left 1158556237 18:58477075-58477097 CCCCTTGTAGTGAAGCTTTCACT 0: 1
1: 0
2: 2
3: 6
4: 122
Right 1158556246 18:58477124-58477146 GCTCCATGGTTGAGCCCTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 85
1158556239_1158556246 24 Left 1158556239 18:58477077-58477099 CCTTGTAGTGAAGCTTTCACTCG 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1158556246 18:58477124-58477146 GCTCCATGGTTGAGCCCTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 85
1158556238_1158556246 25 Left 1158556238 18:58477076-58477098 CCCTTGTAGTGAAGCTTTCACTC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1158556246 18:58477124-58477146 GCTCCATGGTTGAGCCCTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158556246 Original CRISPR GCTCCATGGTTGAGCCCTTC TGG Intergenic
900156946 1:1206961-1206983 GCTCCATGGTTGAGGCTCTCTGG - Intergenic
902752143 1:18524127-18524149 CCTGCAAGGTAGAGCCCTTCTGG + Intergenic
905018823 1:34794738-34794760 GCTCCATGGTCCAGCCGTACAGG - Exonic
909695102 1:78459159-78459181 AGTCCATGGTTGAGACCTACTGG + Intronic
911227054 1:95318013-95318035 TCTCCATGGCTGAGGTCTTCTGG - Intergenic
911900560 1:103497951-103497973 GGTACATGGTTGAGACCTTTAGG - Intergenic
915608082 1:156967507-156967529 GCTCCATGGAAGTGCCCTTGAGG + Intronic
922322688 1:224502403-224502425 GCTCCATGGCTGTGCCTTTCAGG - Intronic
1067948457 10:50707404-50707426 GCTTCATGGATAATCCCTTCCGG - Intergenic
1069855134 10:71436023-71436045 GCAGCAGGGTGGAGCCCTTCAGG + Intronic
1070883777 10:79872399-79872421 GCTTCATGGATAATCCCTTCCGG - Intergenic
1071423854 10:85528652-85528674 GCTCCTTGGTGGGGACCTTCAGG + Intergenic
1077678101 11:4215136-4215158 TCTCCATGGATGGGTCCTTCAGG + Intergenic
1080559825 11:33452740-33452762 GCTCCATAGTTCAGCCTGTCAGG + Intergenic
1091162531 11:133438141-133438163 ACTCCATGGTTGAGAACATCTGG - Intronic
1114568107 14:23647162-23647184 GCTCCCTGCTTGGTCCCTTCAGG + Intergenic
1121067852 14:90985486-90985508 TCACCTTGGTTGAGCCATTCAGG - Intronic
1123964382 15:25439720-25439742 GCTCCCTGGTTGACCCCAGCTGG + Intergenic
1124701510 15:31917477-31917499 GCTCCATTTTTCAGCTCTTCTGG + Intergenic
1126841480 15:52721416-52721438 GCTCCATGGTTGACCCCTGAAGG + Intergenic
1127914538 15:63444619-63444641 GCACCATGGTTCAGCAGTTCTGG - Intergenic
1129266446 15:74395947-74395969 GCTCCTTGGCTGAGCCCTCAGGG + Intergenic
1132358663 15:101193389-101193411 GCTCCAAGGTTGATTCCCTCTGG - Intronic
1139244071 16:65423686-65423708 GCTCCAGGGTTGGTCCCTACTGG + Intergenic
1139481658 16:67234113-67234135 GCCCCAAGGCTGAGCCCATCTGG - Exonic
1140679281 16:77368297-77368319 TGTCCATGGCTCAGCCCTTCAGG - Intronic
1142005208 16:87686486-87686508 ACTCCAGGATTGAGCCCTCCAGG - Intronic
1143576939 17:7799221-7799243 GCCCCATGGGGGATCCCTTCAGG + Exonic
1144373849 17:14619493-14619515 GCTTCATTGCTGAGCCTTTCTGG + Intergenic
1146888150 17:36486105-36486127 GCTCCAACTGTGAGCCCTTCCGG - Intergenic
1147665210 17:42142628-42142650 GCTCCATGTATGTCCCCTTCAGG - Intronic
1148994753 17:51700060-51700082 GCACCATGGTTGTGGCCATCAGG + Intronic
1150645168 17:66973372-66973394 GCTCCATGGTGGACGCCTTCTGG - Intronic
1152725208 17:81941723-81941745 GCTCCATGGTGCTGCCCATCTGG + Exonic
1156439167 18:37166679-37166701 GCTCCATGTGTCAGCCCTTTAGG - Intronic
1156456362 18:37296888-37296910 GCTCCCTGGTTTGGCCCTTGGGG - Intronic
1158528810 18:58239681-58239703 GCTCCATTGCTCAACCCTTCTGG - Intronic
1158556246 18:58477124-58477146 GCTCCATGGTTGAGCCCTTCTGG + Intergenic
1160268017 18:77357490-77357512 GCTCCTTGGTGGAGCTTTTCTGG - Intergenic
1162435640 19:10656354-10656376 GCTCCCTGGTTAAGGCCTCCAGG + Intronic
927940524 2:27100389-27100411 GCTCCAAGGGTGAGACTTTCAGG - Exonic
930321555 2:49861018-49861040 GATCCATGGTACAGCCCTTCTGG + Intergenic
931394674 2:61875668-61875690 GCTTCAGGGTGGAGCCCTTAAGG - Intronic
931924365 2:67055083-67055105 GCTTGATGTTTCAGCCCTTCAGG + Intergenic
932721378 2:74141159-74141181 GCTCCATCACTGAGCCCTCCCGG - Intronic
935819273 2:106877939-106877961 GCACCAGGGTGCAGCCCTTCAGG - Intronic
940791405 2:158033478-158033500 GCTCCCTGGAAGATCCCTTCTGG - Intronic
1169268195 20:4180468-4180490 GCTCCTTGGTCGAGCCCCTGTGG - Intronic
1170191414 20:13648663-13648685 GCTCCAGCCTTAAGCCCTTCAGG + Intergenic
1175839976 20:62020440-62020462 GCTCCACGTCTGAGCCCTGCTGG + Intronic
1175894213 20:62328929-62328951 GCCCCACGTGTGAGCCCTTCGGG - Exonic
1180758271 22:18178400-18178422 GCTATAAGGTTGAGCACTTCAGG - Intergenic
1180768559 22:18362192-18362214 GCTATAAGGTTGAGCACTTCAGG - Intergenic
1180826434 22:18865416-18865438 GCTATAAGGTTGAGCACTTCAGG - Intergenic
1181196621 22:21191765-21191787 GCTATAAGGTTGAGCACTTCAGG + Intergenic
1181212906 22:21301359-21301381 GCTATAAGGTTGAGCACTTCAGG - Intergenic
1203230177 22_KI270731v1_random:103080-103102 GCTATAAGGTTGAGCACTTCAGG - Intergenic
1203276577 22_KI270734v1_random:91322-91344 GCTATAAGGTTGAGCACTTCAGG - Intergenic
952240353 3:31525958-31525980 GCTCCCTGCTTCAGTCCTTCAGG - Intergenic
953401911 3:42630638-42630660 GGACCATGGTTGAGCCCTCAAGG + Intronic
953676092 3:45003538-45003560 CCCCCATGATTGAGCCCTGCTGG - Intronic
954457713 3:50608954-50608976 GCTTCATGTTTGTGCCCTCCTGG + Intronic
955862140 3:63343026-63343048 TTTCCATGATTGATCCCTTCAGG - Intronic
956423736 3:69111371-69111393 TCTCCATGGGAGAGCCCTGCAGG - Intronic
962463013 3:135631885-135631907 CCTCCAAGGTGAAGCCCTTCAGG - Intergenic
967520760 3:190429635-190429657 GCTCCATGTTTTGGCCCTTTAGG - Exonic
977679530 4:99784115-99784137 CCTCCATGGTTAAGCCCATCTGG + Intergenic
985379121 4:189373676-189373698 GCTCCATGGTTTGGCATTTCAGG - Intergenic
988559745 5:32269784-32269806 GATCCATTGTTGAGGCCTTTAGG + Intronic
995653660 5:114400465-114400487 GCAGTATGGGTGAGCCCTTCAGG + Intronic
1000470266 5:161631394-161631416 GCCCCAGGGTGGAGCCCTCCAGG + Intronic
1006129605 6:31861381-31861403 GCCCCAAGGTTCAGCCCATCGGG + Exonic
1011657461 6:89564692-89564714 GCTCCATGGCTTAGCCCCTGAGG - Intronic
1019179246 6:170176547-170176569 GCACCAGGGTCGAGCCCTGCCGG - Intergenic
1019693605 7:2432210-2432232 GCTCCAGGTGTGAGCCCTCCTGG - Intronic
1022795884 7:33731113-33731135 TCTCCTTGGCTGAGCCCTGCTGG + Intergenic
1023360219 7:39407855-39407877 GCTCCATCGTTCAGCCCTCGGGG - Intronic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1026865782 7:73823161-73823183 GCTCCTGGGTTGCGCCCTTGAGG + Intronic
1027192237 7:76003485-76003507 GCTAGATGGCTGTGCCCTTCTGG - Intronic
1030363885 7:108624689-108624711 GCTTCAGGGTGGAGCCCTTGGGG + Intergenic
1034760805 7:153669975-153669997 GCTCCACGGCTCATCCCTTCTGG - Intergenic
1039469602 8:37805034-37805056 GCTCCACGGTACAGCCTTTCTGG - Intronic
1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG + Intronic
1045052043 8:98336262-98336284 GCTCAATGGTTCACCCCTACAGG + Intergenic
1058185378 9:101848454-101848476 GCTCCATGGTGGATCCCTAGAGG + Intergenic
1060656866 9:125378016-125378038 GCTCCATGCTGGAGCCCTAAGGG - Intergenic
1062303815 9:135890581-135890603 GCTCCTGGGTGCAGCCCTTCAGG - Intronic
1192593940 X:72386957-72386979 GCTCCAGAGTGGAGCCCCTCAGG - Intronic
1199400722 X:147395538-147395560 GCTCCAGGGTAGAGCCCTCATGG + Intergenic
1199810651 X:151345367-151345389 GTCCCATCGTTGGGCCCTTCAGG - Intergenic
1199815996 X:151397293-151397315 GCTCCATGGTGTAGCCGTGCCGG - Exonic
1202129956 Y:21600549-21600571 TCTCCATGGTTGGGTCCTACTGG + Intergenic