ID: 1158556715

View in Genome Browser
Species Human (GRCh38)
Location 18:58481096-58481118
Sequence TAAGTTGTAATGTAAGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158556710_1158556715 30 Left 1158556710 18:58481043-58481065 CCCTGGGTTTAGGCAGCTCGGGT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1158556715 18:58481096-58481118 TAAGTTGTAATGTAAGAATGAGG 0: 1
1: 0
2: 1
3: 10
4: 246
1158556711_1158556715 29 Left 1158556711 18:58481044-58481066 CCTGGGTTTAGGCAGCTCGGGTT 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1158556715 18:58481096-58481118 TAAGTTGTAATGTAAGAATGAGG 0: 1
1: 0
2: 1
3: 10
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158556715 Original CRISPR TAAGTTGTAATGTAAGAATG AGG Intergenic
903805325 1:26001265-26001287 TATGTTGGGATGTAAGAAAGAGG - Intergenic
905149159 1:35913377-35913399 CATGTTGTAAGGAAAGAATGTGG - Intronic
908352871 1:63303233-63303255 TAAGTAGTTAGGTAAAAATGTGG + Intergenic
909327226 1:74365794-74365816 TAAGTTATAATGAAATAACGTGG - Intronic
909546743 1:76856571-76856593 TAAGTGGTAGTGTCAGAATTTGG - Intergenic
910465109 1:87490744-87490766 TGAGATGTAATCAAAGAATGTGG - Intergenic
911087897 1:93994650-93994672 TATGTTGTAAAGTCAGAATTAGG + Intronic
911216333 1:95199687-95199709 TGGGTTGTGATGTCAGAATGTGG + Intronic
911909071 1:103609154-103609176 TTAGTTTTCATGTAAGAATAAGG + Intergenic
911913848 1:103670307-103670329 TTAGTTTTCATGTAAGAATAAGG - Intronic
912635426 1:111287661-111287683 TAAGCTGTAGTGTAAGTATAGGG - Intergenic
914359946 1:146925822-146925844 TGAGATGTAATAAAAGAATGTGG - Intergenic
914493805 1:148174073-148174095 TGAGATGTAATAAAAGAATGTGG + Intergenic
915685571 1:157629148-157629170 TAAGTTTCAATGTATGAATTTGG + Intergenic
916167893 1:161979480-161979502 TAAGTTTTAAAATAAGAATTTGG + Intergenic
916284472 1:163090277-163090299 TAAGTTGCAAAATAATAATGAGG - Intergenic
919212048 1:194499190-194499212 TAAGTTTAAATTTATGAATGTGG - Intergenic
922635574 1:227167235-227167257 TCAGTGGTAATGTAAGGACGAGG - Intronic
924746819 1:246842958-246842980 TTAGTTGAATTGTAGGAATGAGG - Intronic
1063740921 10:8818323-8818345 TAGGTTCTAACGTAAGAATTGGG - Intergenic
1064331689 10:14400242-14400264 ATAGTACTAATGTAAGAATGAGG - Intronic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1067578450 10:47423044-47423066 TACTTTGTAATGTAATAGTGCGG + Intergenic
1068668842 10:59704115-59704137 TTAATTGTTATGTAAGAATGAGG - Intronic
1069266329 10:66462794-66462816 TAACTTGAAATGGAAGAATCAGG + Intronic
1069657909 10:70103875-70103897 TACGTTGTCATTCAAGAATGAGG + Intronic
1071749666 10:88460472-88460494 TGAGTTGTGATGTGATAATGAGG - Intronic
1073551390 10:104405111-104405133 TAAATTGTTATGTAAACATGAGG + Intronic
1079201476 11:18380924-18380946 TAAATTTTTATGTAAAAATGAGG - Intergenic
1079454928 11:20628163-20628185 TAAGATGAAATGTGAGGATGTGG - Intronic
1079519666 11:21311591-21311613 TAACTTTTAATGCAAGAATTGGG + Intronic
1079522784 11:21348246-21348268 TAAGATGAAATGTAAAAATATGG + Intronic
1079810469 11:24993128-24993150 TAAATTGTAAAGTTAGAATTTGG + Intronic
1080497639 11:32835801-32835823 TAATTTGTAATTTAAGAACTTGG + Intronic
1080549089 11:33353485-33353507 GATGCTGCAATGTAAGAATGTGG - Exonic
1081031993 11:38096596-38096618 TAAGATGTAATGTCAGATTCTGG - Intergenic
1082218070 11:49599044-49599066 TATCTTGTAATGTGAGGATGTGG - Intergenic
1085136013 11:74089167-74089189 CAAGTTTTAATGTAAGGAAGTGG + Intronic
1086631498 11:89025106-89025128 TATCTTGTAATGTGAGGATGTGG + Intronic
1086880661 11:92149861-92149883 CAAGTTTTAATGGAAGAATCAGG + Intergenic
1087244560 11:95818906-95818928 TAAGTTAAAATGTGAGAAAGTGG + Intronic
1090095241 11:123736403-123736425 TAAGGTATAAAATAAGAATGGGG - Intronic
1090123074 11:124053643-124053665 TAAGATGTAAAGTGATAATGGGG + Intergenic
1090144336 11:124304024-124304046 TATATTGTAATGAATGAATGTGG - Intergenic
1091101326 11:132876543-132876565 TAAGAAGTACTGTAAGCATGAGG - Intronic
1091639506 12:2224552-2224574 TTAGTAGTAAGGGAAGAATGGGG + Intronic
1093202721 12:16208748-16208770 TAAATTTTAATTTCAGAATGAGG + Intronic
1093533185 12:20191386-20191408 TAAGTATTTATGTTAGAATGTGG - Intergenic
1093913479 12:24774000-24774022 TCATTTGTAAAGTGAGAATGTGG - Intergenic
1095354971 12:41261859-41261881 TGAAGTGTAATGTAAGAAAGAGG + Intronic
1098747386 12:74256289-74256311 AAATTTATAATGAAAGAATGGGG - Intergenic
1099648260 12:85388904-85388926 TAACTTGTAATTAAAGAATACGG - Intergenic
1102838042 12:116085677-116085699 TTAGGAGTAATGTAGGAATGGGG + Intronic
1103633469 12:122282454-122282476 TAAGTAGTAAGGAAAGAATCTGG - Intronic
1105226339 13:18436879-18436901 TAATTTGTTAAGTAATAATGGGG - Intergenic
1105436448 13:20382536-20382558 TAACTTATAATCTAATAATGGGG + Intergenic
1109131418 13:58590963-58590985 CAAGTTGTATTGTGAGATTGCGG - Intergenic
1110228577 13:73144767-73144789 TAAGAAGTAATTTAAGAATCTGG - Intergenic
1111216444 13:85148724-85148746 TAATCTGTAATTTAATAATGTGG + Intergenic
1112392015 13:98993962-98993984 CAAGTTGTAATGTGAGATTGCGG + Intronic
1112873113 13:104000026-104000048 TATGTTGTAATGAAACTATGTGG - Intergenic
1113025165 13:105932649-105932671 TAAGATGCCATGTAAGAATTTGG + Intergenic
1113158632 13:107354082-107354104 TAAGTTGTAGTTGAAGAATTAGG - Intronic
1113806404 13:113112264-113112286 TGAGTTGTCCTGTAAGACTGAGG - Intronic
1113806471 13:113112773-113112795 TGAGTTGTCCTGTAAGACTGAGG - Intronic
1114895616 14:26987248-26987270 AAATTTATAAAGTAAGAATGGGG + Intergenic
1116122098 14:40733810-40733832 TAATATGTAATGTGAGAGTGGGG + Intergenic
1117568395 14:57020192-57020214 TAATTTGTTATATAAGACTGAGG - Intergenic
1117816353 14:59602398-59602420 AAAATAGTAATGTAAGAATTAGG + Intronic
1120667536 14:87324532-87324554 TAAGTTGTAATGAGACCATGAGG - Intergenic
1125979073 15:43983388-43983410 TAAGTTGAAAAGTTATAATGGGG + Intronic
1127416473 15:58762544-58762566 AAAGTTCTAAGGAAAGAATGAGG + Intergenic
1130015408 15:80182253-80182275 TAAGTTGGGATCTTAGAATGAGG - Intronic
1131744677 15:95434394-95434416 TTAATTGTATTGTAAGAATAGGG - Intergenic
1132188059 15:99821377-99821399 TTAGTTGTAAGGCAAGAAGGGGG - Intergenic
1138876913 16:60962992-60963014 TAAGTTTTAATTTCTGAATGGGG + Intergenic
1141375918 16:83530693-83530715 TATTTTGTAATGGAAGACTGAGG + Intronic
1143991469 17:10967056-10967078 TAGGTTTTAATGTATGAATCTGG - Intergenic
1144651885 17:17012353-17012375 TAAGGTGTATTGGAAGAAAGAGG + Intergenic
1145053060 17:19679235-19679257 TAAGTTGTCATGAGAGAATACGG - Intronic
1145161115 17:20574326-20574348 TAAGGTGTATTGGAAGAAAGAGG - Intergenic
1146395188 17:32459573-32459595 TGAATTGAAATGTAAGCATGGGG + Intronic
1153286803 18:3464101-3464123 TAAATTGTAATGTGAGGATAAGG + Intergenic
1156950420 18:42890055-42890077 TATGTTGTAATATAAGAAGCTGG + Intronic
1158556715 18:58481096-58481118 TAAGTTGTAATGTAAGAATGAGG + Intergenic
1159263984 18:66055496-66055518 TATGAAGTAATGTAAGAATGGGG - Intergenic
1162998509 19:14351359-14351381 TTTGTAGTAATGTAAGAATTAGG + Intergenic
1164587628 19:29485902-29485924 TATATTGTGATGAAAGAATGTGG - Intergenic
1165603305 19:37077589-37077611 TAAATAGTAATGTAATAATCTGG - Intronic
1167869584 19:52356813-52356835 TAATTTGTTATTTAAGACTGAGG + Intronic
925493057 2:4417009-4417031 TAAGTTGTATTTTAAGAAAAAGG + Intergenic
928825870 2:35420448-35420470 TAAGTTTTAATATATGAATTTGG - Intergenic
930229128 2:48826331-48826353 TAATTTGAAAAGTAAGTATGAGG + Intergenic
930744885 2:54872213-54872235 TAAGTTGGCATTTGAGAATGAGG + Intronic
932518355 2:72378696-72378718 TAAGTAGTAAAATAAAAATGTGG + Intronic
932709979 2:74055654-74055676 TAAGTTTCAATGTAAGTTTGGGG - Intronic
932952683 2:76312835-76312857 TAAGTTGGGAGATAAGAATGAGG + Intergenic
935302588 2:101706009-101706031 AAAGTTATAATGTAAAAGTGGGG - Intronic
935405864 2:102708231-102708253 TAAAATGGAATGGAAGAATGAGG + Exonic
935836165 2:107056683-107056705 TAAATAGGAATGTAAGAAAGTGG + Intergenic
936553376 2:113470604-113470626 TAACATGTAATATAAAAATGAGG - Intronic
937427014 2:121808273-121808295 GAAGTGCTAATGTCAGAATGGGG + Intergenic
939414071 2:141869911-141869933 TAAATTTTAATGAAAAAATGAGG + Intronic
940601167 2:155862591-155862613 TTAGTGGTAATGTTAGGATGTGG + Intergenic
940948228 2:159643410-159643432 TAAGTGAGATTGTAAGAATGAGG - Intergenic
941135923 2:161718379-161718401 TCAGTTGTGATGTTAGGATGTGG + Intronic
941569069 2:167147013-167147035 TAAATTTTAATTTAAGAATGAGG + Intronic
941842783 2:170105725-170105747 GAAGTTGAAAAGTAATAATGGGG + Intergenic
942757448 2:179358716-179358738 TAAGTTTTAAAGTATGAATATGG - Intergenic
944086497 2:195853086-195853108 TAAAATGTAATGTGAAAATGGGG - Intronic
944787689 2:203090166-203090188 TAAGTTCTCATGTAAGAAATAGG + Intronic
945178847 2:207070915-207070937 TTAGTTGTAATTTAAAAATAAGG + Intergenic
945267303 2:207903099-207903121 TAAGTTTTAATGAAAGAAAAAGG - Intronic
945624546 2:212185760-212185782 TCAGTTGTAGTGTAGGTATGGGG + Intronic
946610418 2:221452040-221452062 TAATTTGTCATTTAAGAAAGAGG - Intronic
947174103 2:227344117-227344139 TAAGATTTCATGTAAGCATGAGG + Intronic
1168736717 20:146430-146452 TAAGTTGGAAGCTATGAATGAGG - Intergenic
1174549004 20:51348010-51348032 TGAGATGTAATGAGAGAATGGGG + Intergenic
1176770390 21:13065907-13065929 TAATTTGTTAAGTAATAATGGGG - Intergenic
1176887044 21:14269551-14269573 TAGGCTTTAATGTAAGACTGTGG - Intergenic
1178150500 21:29788886-29788908 CAGGTGGTAATGTGAGAATGGGG + Intronic
1183622623 22:38983343-38983365 TAACATGGAATGTGAGAATGTGG + Intronic
949186829 3:1201943-1201965 TATTTTGTAATGTAATAATTGGG + Intronic
949489806 3:4577925-4577947 TATGCAGTAATGTAAGATTGAGG - Intronic
949573492 3:5316172-5316194 TAAGTTTTAAAATAAGTATGAGG + Intergenic
949656607 3:6227834-6227856 TGAGTAGTAACGTAAGAATTGGG - Intergenic
950847888 3:16032430-16032452 TAAGTTGTAATTCAAGGATGTGG + Intergenic
952052221 3:29398082-29398104 TAAGTTGTAAAGAAGGAATCTGG - Intronic
953123317 3:40067303-40067325 GCAGTTGTAAAGCAAGAATGAGG + Intronic
955854096 3:63254820-63254842 TAAGTTATAATGAAAGCATTAGG + Intronic
955994917 3:64669916-64669938 TAACATGAAATGTAAGAATTAGG + Intronic
956820519 3:72949811-72949833 GTAGTAGTAATGAAAGAATGAGG - Intronic
959247756 3:103896857-103896879 TACGAAGAAATGTAAGAATGAGG + Intergenic
959970855 3:112407859-112407881 TAAAATGTATTGTTAGAATGAGG - Intergenic
960130661 3:114052577-114052599 AAAGATGTAATGGAAGTATGTGG - Intronic
960994630 3:123332730-123332752 AAAGATGTAATGTATGAATTTGG - Intronic
961158889 3:124705301-124705323 TAAGTAGGCATATAAGAATGAGG + Intronic
962833174 3:139161800-139161822 AAAGTAGTACTGTAAGAAGGGGG - Intronic
963347860 3:144117265-144117287 TAAAAAGTAAAGTAAGAATGAGG - Intergenic
963730025 3:148962226-148962248 TCAGTAGTGATGTTAGAATGGGG + Intergenic
963797115 3:149642118-149642140 TATGTTAAAATGTACGAATGTGG + Intronic
963813931 3:149809162-149809184 TAAGCTGTCATTTAAGAGTGAGG - Intronic
964181673 3:153895141-153895163 TTAGTTGTCAAGTTAGAATGAGG + Intergenic
966167096 3:177031800-177031822 TAAAATGTAATGTAAGATTCAGG + Intronic
967166042 3:186780272-186780294 TAAGTTATAGTGTAAGAACATGG + Intergenic
967538072 3:190630549-190630571 AAAGTTGTAATGAAAGTTTGAGG - Intronic
967803404 3:193690062-193690084 TAATTTTTAAACTAAGAATGTGG + Intronic
968558053 4:1260046-1260068 TAAGTTGTAAAGTTAGGTTGCGG + Intergenic
970424624 4:15934771-15934793 AAAGTTGTATTTTAAGAGTGGGG - Intergenic
971825904 4:31622282-31622304 TTAGTTGAAATGTAAATATGAGG + Intergenic
972442443 4:39107987-39108009 TAAGTTGTACTATAAAAATCTGG + Intronic
973096609 4:46209728-46209750 TAAATTGTAATATATGATTGTGG + Intergenic
973660639 4:53102876-53102898 TGAGTTGTAATGAATGAATTTGG - Intronic
976231437 4:82847325-82847347 TAAGATGTACTGAATGAATGAGG - Intronic
977457482 4:97279848-97279870 TAAGTTTTTATGAAACAATGGGG + Intronic
978700812 4:111643772-111643794 TCAGTTGTAATGTTTGGATGTGG - Intergenic
978976358 4:114879563-114879585 TAAAATGTAATGTGAGACTGAGG - Intronic
979302419 4:119101939-119101961 TAAGTTGTCATGTATGGTTGGGG + Intergenic
980418591 4:132527109-132527131 AAAGTTGTATTGGAGGAATGGGG + Intergenic
980967004 4:139531660-139531682 TAAGTTATAATCTAGGAATAGGG - Intronic
982986406 4:162212942-162212964 TATTTTGTAATATAAAAATGTGG + Intergenic
983188197 4:164725074-164725096 TCAGTTGTAATCTAAGTTTGCGG - Intergenic
984077035 4:175196349-175196371 TGCATTGTAATGTAAGGATGTGG - Intergenic
985039101 4:185870849-185870871 AAAGTTGAAATGAATGAATGTGG - Intronic
985155172 4:186979955-186979977 AAAGGGGTGATGTAAGAATGGGG + Intergenic
986558127 5:9032330-9032352 TAAGATGAGATGTAAGAAGGTGG + Intergenic
987752537 5:22059840-22059862 TACATTTTAATGAAAGAATGAGG + Intronic
987817781 5:22926128-22926150 TAATTAGCTATGTAAGAATGTGG + Intergenic
989059504 5:37396580-37396602 TCAGTGGTAATTTAAGAATTCGG + Intronic
989696020 5:44201387-44201409 TATGTTGTTATGGAAGTATGAGG + Intergenic
989975804 5:50585392-50585414 TTGGTTGTACTGTAAGAATGGGG + Intergenic
990475156 5:56155559-56155581 TAACTTGGAATTTAAGTATGAGG + Intronic
990557249 5:56949702-56949724 CAAGTTGTAATGGAAGATTTAGG + Intronic
992874883 5:81044107-81044129 TCAGTTTGATTGTAAGAATGAGG + Intronic
994362092 5:98863569-98863591 TAAAGTGTAAAGAAAGAATGAGG - Exonic
995840079 5:116435741-116435763 TAAATTGTAATCCCAGAATGCGG - Intergenic
997939774 5:138146613-138146635 TAAATTGTAAGGTAAGAATGTGG + Intronic
998064017 5:139142002-139142024 TAAGTTGGACTTTAAGACTGCGG - Intronic
1002110248 5:176904291-176904313 GAAGTTGTAATGAAAAACTGGGG - Intergenic
1004289997 6:14358154-14358176 TAAATTGTATTGTAAATATGGGG + Intergenic
1004943390 6:20585372-20585394 GAAGTTGGAGAGTAAGAATGTGG - Intronic
1009925538 6:70116081-70116103 TAAGTTGTAAAGTAATTCTGGGG - Intronic
1010173788 6:73002482-73002504 TAATTGATAATGTAAGAATGAGG + Intronic
1011943200 6:92868957-92868979 TAGGTTGTAATAAAAGAGTGTGG - Intergenic
1011970879 6:93221064-93221086 TAAGTTGGCATCTAAGAATAAGG - Intergenic
1012223637 6:96680436-96680458 TAAGTTGAAATGTTAGAGTAGGG - Intergenic
1012264053 6:97119811-97119833 TAATTTATAATGAAAAAATGAGG - Intronic
1012305499 6:97652193-97652215 TAAGTTATAATGTATTGATGGGG + Intergenic
1014362456 6:120497115-120497137 AAAGTATGAATGTAAGAATGAGG + Intergenic
1014704066 6:124725196-124725218 TAAATTGTAACTTAAGAGTGGGG - Intronic
1016483914 6:144513589-144513611 TCAGTTGTAATATAAGAATAAGG + Intronic
1017513113 6:155131421-155131443 TTATTTGGACTGTAAGAATGAGG - Intronic
1018920959 6:168173690-168173712 TAACTGGTTATGTAAGAAAGAGG + Intergenic
1020911194 7:14133826-14133848 CAAATTGTCATGTGAGAATGTGG + Intergenic
1021612663 7:22473329-22473351 TAAGATGAAATGTAACAATTTGG - Intronic
1021757296 7:23864907-23864929 TAACTAGTAATGGAAAAATGGGG - Intergenic
1021826507 7:24558029-24558051 TGAGATGTCATATAAGAATGTGG + Intergenic
1023082478 7:36538325-36538347 TATGTAAGAATGTAAGAATGAGG - Intronic
1024121421 7:46245108-46245130 TAAATTGGTGTGTAAGAATGTGG - Intergenic
1025012899 7:55413172-55413194 TATGTTTTAATGTAAAAGTGAGG - Intronic
1025192262 7:56904903-56904925 TAAGTTGTAATGCCCAAATGTGG - Intergenic
1025679686 7:63672029-63672051 TAAGTTGTAATGCCCAAATGTGG + Intergenic
1028024134 7:85815699-85815721 TAAAATGTAATGTAAGAAAATGG - Intergenic
1028815287 7:95136893-95136915 TAATATGTAATGTAAGTTTGAGG + Intronic
1030932441 7:115541641-115541663 TATGTTGTATTTCAAGAATGTGG - Intergenic
1033191788 7:139288035-139288057 TAAGTTGAAGGGTAAGAAAGAGG - Intronic
1033878066 7:145846896-145846918 AAATTTGTAATGTAAGAAAAAGG + Intergenic
1035546519 8:485883-485905 TATGTTTAAATGAAAGAATGGGG - Intergenic
1035782247 8:2237810-2237832 TAAGTTGTGGTATAAGAATCAGG + Intergenic
1035809869 8:2481774-2481796 TAAGTTGTGGTATAAGAATCAGG - Intergenic
1037081407 8:14791593-14791615 TATATTGTAATGTAAAAATTGGG - Intronic
1037156467 8:15705830-15705852 TAAGTTGTAAAGCATGAAGGAGG - Intronic
1037186961 8:16076284-16076306 TAAGTTTTCATGGAAGAATGTGG + Intergenic
1037466961 8:19170421-19170443 TAAGCTGTAATGGAACCATGAGG - Intergenic
1042235681 8:66611822-66611844 TAAGTTGAAATTTAGTAATGGGG - Intronic
1044087592 8:87959312-87959334 TAAGTTGCAAGGTAAGAGTATGG + Intergenic
1045159417 8:99521399-99521421 TTATTTGAAATGTAGGAATGTGG + Intronic
1045656915 8:104396760-104396782 TAAGTTGTGATCTTAAAATGAGG + Intronic
1046507462 8:115154474-115154496 GAAATTGTAAAGTCAGAATGAGG - Intergenic
1047128706 8:121993265-121993287 TGAGTTATAAAGTAATAATGAGG - Intergenic
1048762570 8:137812007-137812029 TAAGTTGAAATCTAAGAGAGTGG + Intergenic
1049899625 9:146563-146585 TAACATGTAATATAAAAATGAGG + Intronic
1050226884 9:3468857-3468879 TATTTTGTAATGAAAGTATGCGG - Intronic
1051042547 9:12829973-12829995 AAAGCTGGAATGGAAGAATGTGG - Intergenic
1051353004 9:16215892-16215914 TAACTTGTTTTGTAGGAATGGGG - Exonic
1052043851 9:23771934-23771956 TAGGTTGGAATGAAAGAATGGGG - Intronic
1052919070 9:33948786-33948808 TAACTTCTTATGTCAGAATGAGG - Intronic
1053742676 9:41156847-41156869 TAACATGTAATATAAAAATGAGG + Intronic
1054347949 9:63986688-63986710 TAACATGTAATATAAAAATGAGG + Intergenic
1054445677 9:65313035-65313057 TAACATGTAATATAAAAATGAGG + Intergenic
1054685666 9:68274452-68274474 TAACATGTAATATAAAAATGAGG - Intronic
1057098718 9:92337584-92337606 CAAGTTGAAATGTAACCATGTGG - Exonic
1057480250 9:95439695-95439717 TGAGTTATTATGTAATAATGAGG - Intergenic
1058844134 9:108938770-108938792 TAAGTTCTAATATTAAAATGAGG + Intronic
1059369800 9:113818762-113818784 AAAGTTTTAATGGAAAAATGAGG + Intergenic
1060026279 9:120174700-120174722 TTTTTTGTAATGCAAGAATGGGG - Intergenic
1061631830 9:131876943-131876965 TATGTTGTAAGGACAGAATGTGG - Intronic
1186780563 X:12908030-12908052 ATAATTGTACTGTAAGAATGTGG + Intronic
1187691756 X:21875735-21875757 AAACTTGTACTGTAATAATGTGG - Intronic
1188110408 X:26191916-26191938 TAAGTTGTGATGCAAGATCGGGG - Intergenic
1189696182 X:43665500-43665522 TAAGTTTCAATGAAAGATTGGGG + Intronic
1192257955 X:69481224-69481246 CAAGAGATAATGTAAGAATGGGG - Intergenic
1193568047 X:83104407-83104429 AAATTTATAGTGTAAGAATGTGG - Intergenic
1193635341 X:83943563-83943585 TCAGTTGTGATGTTAGCATGGGG + Intergenic
1194026049 X:88752306-88752328 TAAGTAGTAAAGCAAGCATGAGG + Intronic
1195264318 X:103165118-103165140 TACTTTTTAATGTAAGAAGGGGG - Intergenic
1195605065 X:106797112-106797134 TAAGCTGTATAGTAAGCATGGGG + Intergenic
1195958672 X:110362242-110362264 TAAGTTTTAGTGTAGGGATGAGG - Intronic
1197937694 X:131756840-131756862 AAAGTTTTAAGGTAAGAATTAGG - Intergenic
1198153681 X:133935870-133935892 TTAGTTGTCATATAAGCATGAGG - Intronic
1199583269 X:149382429-149382451 TAATTTTTAATATAAGAATTGGG - Intergenic
1201781905 Y:17732043-17732065 TAAGTGGGAATGGAACAATGAGG - Intergenic
1201819648 Y:18173947-18173969 TAAGTGGGAATGGAACAATGAGG + Intergenic
1202116616 Y:21474886-21474908 TTAGATTTCATGTAAGAATGAGG + Intergenic
1202173423 Y:22074954-22074976 TAAGTGGGAATGGAACAATGAGG - Intronic
1202217937 Y:22511420-22511442 TAAGTGGGAATGGAACAATGAGG + Intronic
1202325248 Y:23684639-23684661 TAAGTGGGAATGGAACAATGAGG - Intergenic
1202545523 Y:25985415-25985437 TAAGTGGGAATGGAACAATGAGG + Intergenic