ID: 1158558290

View in Genome Browser
Species Human (GRCh38)
Location 18:58492984-58493006
Sequence CATTAAGGAAGTTTGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158558290_1158558297 9 Left 1158558290 18:58492984-58493006 CCAGCCTCCAAACTTCCTTAATG 0: 1
1: 0
2: 1
3: 25
4: 232
Right 1158558297 18:58493016-58493038 GGCCACATAAATCAGCCAGCGGG 0: 1
1: 0
2: 2
3: 8
4: 112
1158558290_1158558296 8 Left 1158558290 18:58492984-58493006 CCAGCCTCCAAACTTCCTTAATG 0: 1
1: 0
2: 1
3: 25
4: 232
Right 1158558296 18:58493015-58493037 TGGCCACATAAATCAGCCAGCGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158558290 Original CRISPR CATTAAGGAAGTTTGGAGGC TGG (reversed) Intronic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
900825591 1:4924113-4924135 CTTTAAGGAAGTGTTGAGGTGGG + Intergenic
901443829 1:9294897-9294919 CACTGAGGAATTTTGGAGTCAGG + Intronic
901662977 1:10810278-10810300 CATTAAAGAAGTTAGGACTCTGG - Intergenic
904191812 1:28750794-28750816 TATTAAAGAAATTTAGAGGCTGG + Intronic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
907883636 1:58574094-58574116 CTGGAAGGAAGTTTGGAGCCTGG + Intergenic
908091082 1:60686122-60686144 CATGAAGGAAGCTGGGAGGGGGG + Intergenic
908118640 1:60965225-60965247 CATGAAGGAAGCTGGGAGGGGGG - Intronic
908159728 1:61394614-61394636 CACTAAGGAATATAGGAGGCTGG + Intronic
908681756 1:66669612-66669634 CATTATGGAAGTTTGGATACAGG - Intronic
908815230 1:68024997-68025019 TATAAAGGAAGTCTTGAGGCAGG + Intergenic
910844081 1:91588520-91588542 CTTTAAGGAAGTTTGATGGAAGG - Intergenic
912147267 1:106809280-106809302 CATGAAGGAAGCTTGGAGGGGGG - Intergenic
913070120 1:115290878-115290900 AATTAAGGAACACTGGAGGCAGG - Intronic
914050631 1:144127310-144127332 CTTTAAAGACGTTTGCAGGCTGG + Intergenic
914128551 1:144838135-144838157 CTTTAAAGACGTTTGCAGGCTGG - Intergenic
916239038 1:162621160-162621182 CTTTCAAGAAGTTTTGAGGCTGG + Intergenic
916535746 1:165701606-165701628 CTTTAAGCAAGTTGTGAGGCAGG - Intergenic
916693786 1:167217009-167217031 CACAAGGGAAGTTTGGAGGAGGG - Intergenic
917100156 1:171437270-171437292 TATAAAGAAATTTTGGAGGCTGG + Intergenic
917262510 1:173185843-173185865 TATTAACTATGTTTGGAGGCTGG + Exonic
919221852 1:194639883-194639905 CATGAAGGCAGCTTGGAGGTTGG + Intergenic
919492782 1:198226651-198226673 CATTATGGGAGTTATGAGGCAGG - Intronic
919534396 1:198769057-198769079 CATCAAGGAAGTCTGGAGCTGGG - Intergenic
921273238 1:213491206-213491228 CATTAAGTAAGTTATTAGGCTGG + Intergenic
921530745 1:216279577-216279599 CATTCAGGAAGTTTGGGGTTGGG - Intronic
924002151 1:239566207-239566229 AATTAAGGATGCTTGGAGGCCGG - Intronic
1064321594 10:14310259-14310281 CATTCAGGGAGTTAGGATGCGGG - Intronic
1064849630 10:19696141-19696163 CATGAAGGAACTCTGCAGGCTGG + Intronic
1065033064 10:21608062-21608084 CAATCAGGAACTATGGAGGCCGG - Intronic
1065432964 10:25678109-25678131 CATTAAGAAAGTTTGGTGAGTGG + Intergenic
1065662262 10:28018247-28018269 CAGTAAGCAAGTTTAGAGGCAGG - Intergenic
1069141241 10:64828526-64828548 CATAAAGGTAGGTAGGAGGCAGG + Intergenic
1070025680 10:72629202-72629224 CATTAAAGAAATTTGCAGCCGGG - Intergenic
1070230522 10:74561742-74561764 GATGATGGAAGTATGGAGGCTGG + Intronic
1072794714 10:98345805-98345827 CATTAAAAAAGCTTGCAGGCTGG - Intergenic
1072981085 10:100098127-100098149 CGTAAATGAAGTTTGGAAGCAGG + Intergenic
1074011888 10:109490596-109490618 CATAAAAGAAATGTGGAGGCCGG + Intergenic
1074137646 10:110642453-110642475 CACTAAGGAAGTCTGGGGGTGGG + Intergenic
1074198115 10:111207228-111207250 CCTTAAAGGAGTTTAGAGGCTGG - Intergenic
1074829387 10:117238225-117238247 CATTAATTAATTTTTGAGGCAGG + Intergenic
1075011993 10:118880380-118880402 CATTAAGGCAGTTTGTGGGGTGG + Intergenic
1075145470 10:119879316-119879338 CATTGTGGAAGGGTGGAGGCAGG + Intronic
1078576099 11:12503856-12503878 CATTAAGAAAGGCTTGAGGCTGG + Intronic
1082943688 11:58735529-58735551 TATTAAGGAATGCTGGAGGCTGG - Intergenic
1086942697 11:92814934-92814956 CATTCAGGAAGATAGGAGCCAGG + Intronic
1087929578 11:103961400-103961422 CATTTAGGAAGGCTGGAGGAAGG + Intronic
1088860477 11:113794548-113794570 AATTAAGAAAGTGTGAAGGCTGG + Intergenic
1089860632 11:121587247-121587269 CATCATGCAATTTTGGAGGCTGG + Intronic
1090051658 11:123385448-123385470 CAAGAAGGAAGTGAGGAGGCTGG - Intergenic
1090253435 11:125266492-125266514 GATTATGGATGTGTGGAGGCAGG + Intronic
1090429595 11:126634902-126634924 CACTAGGGAAGTGTGGAGGGAGG + Intronic
1090825830 11:130385088-130385110 CAAAAAGACAGTTTGGAGGCTGG - Intergenic
1090999131 11:131893719-131893741 CATCAAGGAAGCCTGGAGGTGGG + Intronic
1092232860 12:6786634-6786656 CATGTAGGAAGTGTGGAGGTGGG - Intergenic
1092463005 12:8702987-8703009 CATTAGAAATGTTTGGAGGCTGG + Intronic
1093173446 12:15884233-15884255 CATGAAGGAACATTGGAGTCAGG - Intronic
1093930889 12:24954287-24954309 CTATATGAAAGTTTGGAGGCTGG - Intergenic
1093973991 12:25401081-25401103 CATGAAAGCAGTTTGGAGGGAGG + Intergenic
1094075180 12:26464697-26464719 CCTTTATGAAGTTTGGAGTCTGG + Intronic
1096169144 12:49452859-49452881 CTTTAAAGAAATTTGGAGGCCGG + Intronic
1099200603 12:79672366-79672388 CATTACAGAGGTTTTGAGGCAGG - Intronic
1099548748 12:84016535-84016557 CATTGAGGATGTTGGGAGGAGGG + Intergenic
1099769107 12:87029665-87029687 CATGAAAGAAGCTTGGAGGGAGG - Intergenic
1100436212 12:94573676-94573698 CATTCAGGAGGAATGGAGGCAGG - Intronic
1101195125 12:102373738-102373760 CATTAAGAAATGTTGGAGTCTGG - Intergenic
1102647566 12:114413817-114413839 CATTAAGCAAGATGGGAGGGAGG + Intergenic
1104701191 12:130905396-130905418 GATTAAGGAAGTTAGAAGACTGG + Intergenic
1105423338 13:20272445-20272467 CTTAAAGGAAGTTTGGGGGAAGG - Intergenic
1107301261 13:38968203-38968225 CCTTGAGGAAGTTTGGTAGCAGG - Intronic
1108446722 13:50516804-50516826 CATTAAGAAGGTTTGGCTGCAGG - Intronic
1108470989 13:50766750-50766772 AATTAAAGAAGTTTGGAGCATGG + Intronic
1108715622 13:53075250-53075272 AATTAAGGAATTTTGAAGACAGG + Intergenic
1109771326 13:66977420-66977442 CATAAAGAAAGTTTTGATGCTGG + Intronic
1110307980 13:74012587-74012609 CATTTAAGAATTTTGGAGGATGG - Intronic
1112374570 13:98826735-98826757 CATTCAGGAAGATTGGAAGGTGG - Intronic
1112770582 13:102790675-102790697 CATCAAGGGAGTTTGGAGCCTGG - Intronic
1113681560 13:112248248-112248270 CACTGAGGAAGATTGGAGGAAGG + Intergenic
1113697525 13:112356554-112356576 CATTAAGAAAGTGGAGAGGCTGG - Intergenic
1116228193 14:42180686-42180708 CAATCAGAAAGGTTGGAGGCAGG + Intergenic
1121174284 14:91879172-91879194 CCTAAAAGAAGTTTGGAGGAGGG + Intronic
1121179341 14:91916821-91916843 GATGAAGGAAGTTTGGATGGTGG - Intronic
1121424133 14:93836199-93836221 CATCATGTAATTTTGGAGGCTGG - Intergenic
1122103585 14:99433731-99433753 CATTAAAGAATTTTTAAGGCCGG - Intronic
1123445359 15:20326905-20326927 CTTTAAAGACGTTTGCAGGCTGG - Intergenic
1126100256 15:45114435-45114457 CGTTAAGGAAGCGTGGAGGTGGG - Exonic
1126745776 15:51825001-51825023 CATTATGGAAGCTTGGAGGTAGG - Intergenic
1126906994 15:53378645-53378667 AATTAGCGAAGTTAGGAGGCAGG + Intergenic
1128586298 15:68853139-68853161 TATTAAGGATGATTGGAGCCAGG + Intronic
1131322854 15:91412266-91412288 CATTAACCAAGTTTAGAGACTGG + Intergenic
1131387681 15:92020595-92020617 GATTAAGGAAGTGAGGAGGATGG + Intronic
1131980737 15:97992173-97992195 GATTCAGGAAGCTGGGAGGCTGG + Intergenic
1132533434 16:465464-465486 CATTTTGGAAGATTGGAGGAGGG + Intronic
1133248191 16:4463149-4463171 CATTAAAGAATCTGGGAGGCTGG - Intronic
1133354943 16:5129253-5129275 CTTTAAGTATGTTTGGATGCTGG + Intergenic
1133443022 16:5836504-5836526 GAATAAGGAAGTATGGAGGATGG - Intergenic
1134904285 16:17966659-17966681 CATTAGGAAACTTTGGAGGAAGG + Intergenic
1135506320 16:23039955-23039977 CATATATGAAGTCTGGAGGCAGG - Intergenic
1136620695 16:31426817-31426839 CATTAAGAAAGATTATAGGCCGG + Intergenic
1137522635 16:49208130-49208152 CTTTTAGGGAGTTTAGAGGCTGG + Intergenic
1137782437 16:51108968-51108990 CATGAAGGAAGAGTGGAGGAGGG - Intergenic
1138846547 16:60573667-60573689 GATTCAGGAAGTTTGGAAGGTGG - Intergenic
1139725757 16:68896637-68896659 CATCAAGGAAGTTTAAAGGGAGG + Intronic
1143645667 17:8228486-8228508 CATTAGGTAAGGTTGGAGACGGG - Exonic
1144078029 17:11736484-11736506 CTTTCAGGATGCTTGGAGGCAGG - Intronic
1144178056 17:12727656-12727678 CCTTAATGAAGTTTGGAGGGAGG - Intronic
1144455749 17:15416985-15417007 CATTAAAGAAATTTGGGGTCTGG + Intergenic
1145928237 17:28664098-28664120 CAAGATGAAAGTTTGGAGGCAGG - Intronic
1146953416 17:36921870-36921892 CAAGAAGGAAGTTTGCAGTCTGG + Intergenic
1147803273 17:43110188-43110210 CATAAAGAAAGATTCGAGGCCGG - Intronic
1149370914 17:55992812-55992834 CATTAAAGCAGCTTGGAGGGAGG - Intergenic
1150678318 17:67263894-67263916 CATAAAGGAGATTTGGAGGTGGG - Intergenic
1150999617 17:70359424-70359446 CATTTAGGAGGTATGGAGGTAGG - Intergenic
1151154324 17:72114216-72114238 CATCAAGGTGCTTTGGAGGCAGG - Intergenic
1155108562 18:22690953-22690975 CTTTAAGGAAGTGAGGAGTCAGG - Intergenic
1156390390 18:36644896-36644918 AATCAAGGAATTTTGGAGGGAGG + Intronic
1156451768 18:37270606-37270628 CCTGAAGGAAGATGGGAGGCTGG + Intronic
1156584856 18:38420849-38420871 CATAAAGGAAGGTTAGAGACAGG - Intergenic
1156982532 18:43307368-43307390 CAGTAAGAAAGTTTGTAGACAGG + Intergenic
1157373534 18:47140810-47140832 AATTAAGAAAGTTTGGGGCCAGG - Intronic
1157817271 18:50738718-50738740 TTTTAAGGAATTATGGAGGCTGG - Intergenic
1158405454 18:57155767-57155789 CATCAAGGAAGCTGGAAGGCTGG - Intergenic
1158558290 18:58492984-58493006 CATTAAGGAAGTTTGGAGGCTGG - Intronic
1158939541 18:62394206-62394228 CAGTAAGGAAGTTGGGATGACGG - Intergenic
1159974737 18:74696823-74696845 CTGCAAGGTAGTTTGGAGGCAGG + Intronic
1161614501 19:5262545-5262567 AATTACAGAAGTTTGGGGGCTGG - Intronic
1161836772 19:6653108-6653130 CTTTAAGGAAATGTGTAGGCCGG + Intergenic
1162872489 19:13597259-13597281 AATTAATTAATTTTGGAGGCAGG - Intronic
1167211961 19:48139168-48139190 CATCCAGGAAGTTTGGAAACGGG - Intronic
1168094885 19:54108830-54108852 CCTTAAGGAACTCTGGAGGCAGG - Intronic
1202690038 1_KI270712v1_random:79948-79970 CTTTAAAGACGTTTGCAGGCTGG + Intergenic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
927698869 2:25254950-25254972 GAATAAGGAAGTTTGACGGCCGG - Intronic
928595187 2:32853333-32853355 GTTTAAGGAAATTTTGAGGCTGG + Intergenic
930067123 2:47336136-47336158 AAATAAGAAAATTTGGAGGCTGG - Intergenic
930763761 2:55063076-55063098 TATAAACGAAGTTTAGAGGCAGG - Intronic
930844420 2:55886610-55886632 CATTAAGAATGTTGGGAGGAAGG - Intronic
932039443 2:68283660-68283682 CCTGGAGGCAGTTTGGAGGCAGG - Intergenic
932288876 2:70558501-70558523 CATTAAGCGTGCTTGGAGGCAGG + Intergenic
933956377 2:87376075-87376097 CTTTAAAGACGTTTGCAGGCTGG - Intergenic
934240526 2:90268100-90268122 CTTTAAAGACGTTTGCAGGCTGG - Intergenic
934272667 2:91548657-91548679 CTTTAAAGACGTTTGCAGGCTGG + Intergenic
937418439 2:121736318-121736340 CATTCGGGAAGTTTGTATGCCGG - Intronic
937430628 2:121835226-121835248 CATGAAGGAAGTTTGAATTCTGG - Intergenic
937886665 2:126904025-126904047 CATGAAGGTACTTTGGAGGGTGG - Intergenic
940334995 2:152517296-152517318 CATTAAGGATATTTGCAGGCTGG + Intronic
940621782 2:156121994-156122016 CATGAAGGAAGCTGGGAGGAGGG + Intergenic
941017948 2:160378316-160378338 AATTAAAGCAGTTTGGAGACTGG + Intronic
943173423 2:184434144-184434166 CATAAAGGAACTTTGTATGCTGG - Intergenic
945070284 2:205982380-205982402 CATTAAGAATGTTTGGGGCCGGG - Intergenic
946890084 2:224266144-224266166 CATTGAGGAAAGTTGGATGCAGG + Intergenic
947391511 2:229644094-229644116 CATTTGGGAAATTTGGGGGCAGG - Intronic
1169313027 20:4563669-4563691 CATTAAGTAAGTGTGGAGTGAGG + Intergenic
1169427712 20:5509652-5509674 CATCAAGGGAGGCTGGAGGCAGG + Intergenic
1169932442 20:10849019-10849041 AATTAAGGACATTTGGAGGCGGG - Intergenic
1173078556 20:39844394-39844416 TATTAAGAAAGTCTGGAAGCAGG + Intergenic
1173081224 20:39869972-39869994 CATTAAGGTATATTGGAGGATGG - Intergenic
1173135940 20:40438961-40438983 AATTCTGGAAGTTTGGTGGCTGG - Intergenic
1173894855 20:46542947-46542969 CACTCAGCAAGTTTTGAGGCTGG - Intronic
1174522306 20:51141203-51141225 CAGTAAAGGAGTTTGGAGGTGGG + Intergenic
1174570858 20:51500481-51500503 AATTAAGTAAGTTTAGAGGTAGG + Intronic
1174980292 20:55386782-55386804 CATTAAGGAAGGCTGGGAGCAGG + Intergenic
1178686969 21:34719574-34719596 CTTAAGGAAAGTTTGGAGGCCGG - Intergenic
1180551386 22:16544619-16544641 CTTTAAAGATGTTTGCAGGCTGG - Intergenic
1181352623 22:22269308-22269330 CTTTAAAGATGTTTGCAGGCTGG + Intergenic
1182154510 22:28056692-28056714 CATTAAGGAAGTTTTGACAAAGG + Intronic
1184311246 22:43644565-43644587 CACTAAGTAAGGTTGGAGGAAGG - Intronic
950372653 3:12544140-12544162 AATTAAGGAAGTTAGTAGGCAGG + Intronic
951533839 3:23723817-23723839 AAGAAAGTAAGTTTGGAGGCAGG + Intergenic
952103686 3:30044497-30044519 GATTAAGTAGGTTTGGAAGCAGG - Intergenic
953169193 3:40492165-40492187 AGTTAAGGAAGTTTGTAGCCAGG + Intergenic
957282563 3:78172444-78172466 CTTTCAGGAAGTTTTGAGGCAGG - Intergenic
958175353 3:89989820-89989842 CATGAAAGCAGCTTGGAGGCAGG + Intergenic
960017428 3:112907777-112907799 CATTAACGTATTTTGGAGGATGG - Intergenic
960317780 3:116199188-116199210 CTATAAGGAAGTTTGGAGCTGGG + Intronic
961560833 3:127728549-127728571 CAGTAAGGCAGAATGGAGGCAGG - Intronic
962485519 3:135838805-135838827 CATTAGGGAAGGTTGGAGGCTGG - Intergenic
962581862 3:136805243-136805265 CATTTAGGAAATTTGGTGGCAGG + Intergenic
964455845 3:156865198-156865220 CATTAAGGTAGTGTTGAGGCTGG + Intronic
970284851 4:14500452-14500474 CATTAAGGAAATATTGTGGCTGG + Intergenic
971240360 4:24883017-24883039 GGATAAGGAAGTTAGGAGGCTGG - Intronic
971522041 4:27566075-27566097 CATTTTGGAAGTTAGAAGGCAGG + Intergenic
972492148 4:39597891-39597913 AATCAAGGAAGTATGCAGGCAGG + Intronic
972800908 4:42474740-42474762 GATTAGGTAAATTTGGAGGCAGG - Intronic
973055045 4:45646318-45646340 TGTTAAGGGAGTTTGGAGGAAGG - Intergenic
975574033 4:75845371-75845393 CATTAAGGAAGTATGAAAGAGGG + Intergenic
976103603 4:81592664-81592686 CATTAATGAAGTTAAGAGTCTGG + Intronic
977664429 4:99629249-99629271 CATCCAGGAAGGTAGGAGGCAGG + Intergenic
977848825 4:101799576-101799598 GATTAAGAAAATTTGGTGGCCGG + Intronic
979624904 4:122833846-122833868 CATTTCGGAATTTTGGAGACTGG + Intronic
980059629 4:128115264-128115286 GATTTAAGAATTTTGGAGGCTGG + Intronic
983254444 4:165381784-165381806 CTTTAAGGAAGTTTGGAAAAAGG + Intronic
984068054 4:175074392-175074414 CTTTGAAGAAGTTTTGAGGCTGG + Intergenic
984466978 4:180112006-180112028 CACTTAGGAAGTGTGGAGGTGGG + Intergenic
984885471 4:184445739-184445761 CATAAAGGAAGGGTGGAGGAAGG - Intronic
987781311 5:22439681-22439703 CATCAAGGAAGTATACAGGCAGG + Intronic
989200304 5:38756644-38756666 CATTAAGGAAGTTGGGACTACGG + Intergenic
990480370 5:56204823-56204845 AAGTAAGGAAGATTGGAGGAAGG - Intronic
990730369 5:58801966-58801988 TATTAACGCAGTTTGGATGCTGG - Intronic
992075458 5:73188806-73188828 CATAAAGGAAGTCTAGAGGTAGG + Intergenic
996353178 5:122568173-122568195 CATTAAAGATTTTTGCAGGCAGG - Intergenic
996507220 5:124281023-124281045 CATAACGGAAGTTTGCAGGCTGG - Intergenic
997645104 5:135476719-135476741 CAAGAAGGAAATTTGGAGGCAGG + Intergenic
998355540 5:141532459-141532481 AATTAAGGAATTAAGGAGGCTGG - Intronic
1002207544 5:177573988-177574010 CACTGAGGAAGTCTGTAGGCAGG - Intergenic
1004596779 6:17106444-17106466 CATTAAGGAATCTTGGAACCAGG - Intronic
1006423150 6:33948089-33948111 CATTAATGAATTTGTGAGGCTGG + Intergenic
1006732095 6:36243831-36243853 CCTCCAGGAAGTTTGGAAGCTGG + Intronic
1007192403 6:40030801-40030823 CATTCAGGGAGGTTGGAGGGAGG - Intergenic
1008747234 6:54686925-54686947 CATAAAGGAATATTGGAGGCTGG - Intergenic
1009270518 6:61607982-61608004 CATTAAAGAAATTTCTAGGCCGG - Intergenic
1010173422 6:72998763-72998785 CATTAAGAAAGTTTTGAGGGAGG - Intronic
1010733822 6:79419125-79419147 TATAAAGGAATTTGGGAGGCTGG - Intergenic
1012926519 6:105273610-105273632 CTTTAAGGAATTTTGGGGGTGGG - Intergenic
1014289130 6:119538689-119538711 CACTATGGGACTTTGGAGGCAGG - Intergenic
1015193183 6:130494322-130494344 CATTAGGGAAATTTGGAGGGTGG - Intergenic
1017736964 6:157374179-157374201 CTATAAGAAAGTTTTGAGGCCGG + Intergenic
1019895851 7:3982542-3982564 CATTAAGAATGTTTGTGGGCTGG + Intronic
1023410554 7:39885514-39885536 CCTAAAGAAAGTTTGGGGGCCGG + Intergenic
1024025350 7:45405432-45405454 CTTTATGGATATTTGGAGGCAGG + Intergenic
1024582838 7:50813902-50813924 TATTAAGAAAGTCTGGGGGCCGG - Intergenic
1026334812 7:69384500-69384522 CAATAAGGAAGCTTGTAGGAAGG - Intergenic
1028519587 7:91715460-91715482 AATTAAGGAAATTTGCAGGATGG - Intronic
1029303868 7:99604595-99604617 CAGTAAGGAGGGATGGAGGCGGG + Exonic
1033618305 7:143038569-143038591 CAGTTAGGAAGTTTTGTGGCAGG - Intergenic
1037747095 8:21654438-21654460 CATTGAGGAAGGGTGGAGACAGG - Intergenic
1039603188 8:38859089-38859111 ATTTAAGGCAGTTTGCAGGCAGG + Intergenic
1040432606 8:47358811-47358833 CATTTAGGAAGTTAGGACGTAGG + Intronic
1041101087 8:54397027-54397049 CATTAGAGAAGTTGGGAGGCAGG - Intergenic
1041477829 8:58285320-58285342 CATTAACTAAGTGTGGTGGCTGG + Intergenic
1042974417 8:74451151-74451173 CTTTAAGGAAATTAAGAGGCTGG + Intronic
1043402479 8:79897567-79897589 AATTAAGGGAGTTTGATGGCTGG - Intergenic
1044019669 8:87089567-87089589 CTTTAAGGAAGGTTGGAAGACGG + Intronic
1044423087 8:92021416-92021438 CATCAGGGAAGGGTGGAGGCTGG - Intronic
1044607001 8:94056649-94056671 GATTGGGGAAGTTTTGAGGCAGG - Intergenic
1046538142 8:115543041-115543063 CATTATGGCAGTTTTGAAGCAGG + Intronic
1047924556 8:129669894-129669916 CGTGAAGGAAGCTGGGAGGCAGG + Intergenic
1050046981 9:1557070-1557092 CATGAAGTAAGTGTGGAGGCAGG + Intergenic
1050418834 9:5441035-5441057 CATTCAGGGAGATGGGAGGCAGG + Intergenic
1054779727 9:69155387-69155409 CAGTATGGAAGTTTGGCTGCTGG - Intronic
1054785894 9:69209988-69210010 CTTTAAGAAAATTTGTAGGCTGG + Intronic
1056290838 9:85142390-85142412 CACTAAGGAAGTTGGAAGACAGG + Intergenic
1058010562 9:99972205-99972227 CATTAAGAAATCTTGCAGGCAGG - Intergenic
1058961726 9:109998335-109998357 CTTTGAGGAAGTCTGGAGCCCGG - Intronic
1060138778 9:121185292-121185314 CATTAGGGAAGTTTGGTGAAGGG - Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1188356104 X:29193610-29193632 GATTAGGGCAGGTTGGAGGCGGG + Intronic
1189091105 X:38083870-38083892 GACTATGGAAGTTGGGAGGCAGG - Intronic
1189406734 X:40732220-40732242 CATCAAGAAGGTTTGGAGGCTGG + Intronic
1189617623 X:42800054-42800076 CTTAAAAGAAGTCTGGAGGCTGG - Intergenic
1190865999 X:54385098-54385120 TTTTATGGAGGTTTGGAGGCTGG + Intergenic
1193668127 X:84349466-84349488 CATTAAGGGAGTTAGGAGCTAGG + Intronic
1199118535 X:144021952-144021974 CAGCAAGGAAGTTTGGAAGCAGG - Intergenic
1199227713 X:145396969-145396991 CATTAATGGAATTTGGAAGCTGG + Intergenic
1200286934 X:154831901-154831923 CAATTAGGAAGTTTGTAGGAGGG - Intronic
1200668095 Y:6053193-6053215 AACAAAGGAAGTTTGGAGGTTGG - Intergenic
1201695695 Y:16822831-16822853 CAAGAATAAAGTTTGGAGGCAGG - Intergenic
1202075438 Y:21033150-21033172 CATGAAGGAAGTTTGCAGAGAGG + Intergenic