ID: 1158558949

View in Genome Browser
Species Human (GRCh38)
Location 18:58497975-58497997
Sequence CCTTCCAGGCAGACACTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158558949 Original CRISPR CCTTCCAGGCAGACACTGTC AGG (reversed) Intronic
901219333 1:7574274-7574296 CCTTCCAAGCAGACACTGCCAGG + Intronic
903439793 1:23379103-23379125 CCTTCCAGGAAGTCACAGCCTGG - Intergenic
905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG + Intergenic
905888340 1:41503743-41503765 CCTTTGAGGCTAACACTGTCAGG + Intergenic
909102364 1:71365155-71365177 CCTGTGAGGCAGATACTGTCAGG - Intergenic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
912950618 1:114118050-114118072 CCTTCCAGTGAGGCATTGTCAGG - Intronic
913414428 1:118589576-118589598 CCTTCCAGGCAGACAGTCTGTGG + Intergenic
915085374 1:153384624-153384646 CCTTCCTGGCAGAGTATGTCAGG + Intergenic
918590115 1:186231656-186231678 CCTTCCAGGAAAACACTTTCTGG + Intergenic
921933225 1:220772555-220772577 CCTTGCAGGCAGACACAGTGAGG - Intronic
921945235 1:220881587-220881609 CCGTCCACGCACACACTTTCTGG - Intronic
922054572 1:222028427-222028449 CTTTCCAGGAAGGCATTGTCAGG + Intergenic
923761291 1:236847379-236847401 TCATCAAGGCAGACACTGTGAGG - Intronic
924631810 1:245747903-245747925 TCTTCCAAACGGACACTGTCTGG - Intergenic
1064265525 10:13822411-13822433 CCTTCCAGGAACTTACTGTCTGG - Intronic
1067693687 10:48520465-48520487 CCTTCAAGGCAGAGCCTGACAGG + Intronic
1072626989 10:97119048-97119070 CCATTCAGGCAGGCACTGCCTGG + Intronic
1073549222 10:104382118-104382140 CTTTCCAGGCTGACTCTGTCAGG + Intronic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1076992477 11:282645-282667 CCTTTCCGGCAGGCACTGTGAGG + Intronic
1077225558 11:1437742-1437764 CCTTCCAGGCAGGCTGTGCCTGG - Intronic
1077437982 11:2553298-2553320 CCCCACTGGCAGACACTGTCAGG - Intronic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1083459018 11:62798754-62798776 CCTTCAAGGCAGTCCATGTCTGG - Intronic
1084160458 11:67346334-67346356 ACATCAAGGAAGACACTGTCAGG - Intronic
1084830545 11:71765471-71765493 CCTTCCAGGCAGGCTGTGTGGGG + Intergenic
1088993675 11:114977560-114977582 CCTTACACGTAAACACTGTCAGG + Intergenic
1089995366 11:122901990-122902012 CCTTCCAGTGAGACACGGTATGG - Intronic
1090162555 11:124510652-124510674 CCTTGCAGGCAGGCACAGCCAGG + Intergenic
1094827837 12:34286501-34286523 CCTTCCCAGCAGCCACTGTGTGG + Intergenic
1096094611 12:48925933-48925955 TCTGCCAGCCAGACACTGCCAGG - Intronic
1096464777 12:51842270-51842292 CTTTCCAGGCACACTGTGTCCGG - Intergenic
1096875944 12:54630681-54630703 CCTTCCAGGCAGCCTGTGACTGG + Intergenic
1099926408 12:89024076-89024098 TCTTCCAGGGAGACCCTCTCTGG + Intergenic
1100925891 12:99547608-99547630 CCTCCTAGGGAGACACTTTCAGG - Intronic
1102051468 12:109865207-109865229 CCCTCCAGGCAGACAGGTTCTGG - Intronic
1102305280 12:111800042-111800064 CCCTCCAGGCGGGCACTGTGTGG + Exonic
1102441620 12:112967992-112968014 GCTCCCAGGCATACACAGTCAGG - Exonic
1104897280 12:132170594-132170616 CCATCCTGGCAGACACTCCCAGG + Intergenic
1105522050 13:21140126-21140148 CCTTCCAGCCACACACAGTTCGG - Intergenic
1105780559 13:23702187-23702209 CTTTCCAGACTGTCACTGTCAGG + Intergenic
1108215457 13:48179391-48179413 CTTTCCAGGCAGACATAATCTGG - Intergenic
1108387183 13:49910321-49910343 CCTGGCAGGGAGACACTGTTGGG - Intergenic
1110553923 13:76837134-76837156 CCTTCCAAGCAGCCACATTCTGG + Intergenic
1113798818 13:113075886-113075908 CTGTCCAGGCACACACTGCCGGG - Intronic
1114043247 14:18699527-18699549 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114047538 14:18889973-18889995 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114114985 14:19511672-19511694 CCATCCAGGAAAACACTGGCTGG - Intergenic
1114116676 14:19629435-19629457 CCATCCAGGAAAACACTGGCTGG - Intergenic
1118123107 14:62868129-62868151 CCTTCCAGGCATAGAGGGTCAGG - Intronic
1118585601 14:67349536-67349558 CCTGCCAGGAAGGCACTTTCTGG - Intronic
1122051413 14:99063203-99063225 CCTGTCAGGCAGCCTCTGTCAGG + Intergenic
1122424589 14:101598468-101598490 CCTTCCTGCCAGACCCTGACTGG + Intergenic
1122477162 14:102018396-102018418 CCTTCCTGGGAGGCGCTGTCAGG + Intronic
1122717075 14:103702243-103702265 GCTTCCCTGCAGACACTGGCTGG - Intronic
1122982069 14:105196480-105196502 CCCTCCAGGGGGACACTGTGAGG - Intergenic
1124030263 15:26004216-26004238 CCTTCTAGGCAATCACTGCCAGG - Intergenic
1124412217 15:29445874-29445896 AATTCCAGGCAGACAGTGTCAGG + Intronic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1126412025 15:48382049-48382071 CCTGCCAGGCTGACTGTGTCAGG + Intergenic
1127111244 15:55673454-55673476 CGAACCAGGTAGACACTGTCAGG + Exonic
1128674357 15:69597726-69597748 CCTCCCCTGCAGACACGGTCTGG - Intergenic
1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG + Intergenic
1132887849 16:2190272-2190294 CCTTCCAGGCAGGCACCACCCGG + Intronic
1133353295 16:5117292-5117314 CCTTCCAGGCAGCCTGTGTGGGG - Intergenic
1134823447 16:17265335-17265357 TCCTCTAGGCAGAGACTGTCAGG - Intronic
1135355205 16:21763284-21763306 CCTGCCAGGTAGGCACTGTTAGG + Intergenic
1135453689 16:22579426-22579448 CCTGCCAGGTAGGCACTGTTAGG + Intergenic
1135752093 16:25066195-25066217 ACAGCCAGGCAGACACTGTTTGG + Intergenic
1136070065 16:27782329-27782351 ACTCCCAGGCTGCCACTGTCAGG + Intergenic
1138155841 16:54702189-54702211 CCTCCCAGGCAGAGGCCGTCAGG - Intergenic
1144033603 17:11343546-11343568 CATCCCAGGCAGACAACGTCAGG - Intronic
1145897614 17:28469552-28469574 CCCTCCGGGCACAGACTGTCTGG - Intronic
1148436864 17:47692340-47692362 CCCTCTAAGCACACACTGTCTGG - Intergenic
1148846510 17:50533010-50533032 CCTTCCATGCCGCCACTGCCAGG - Intronic
1150123443 17:62621645-62621667 GCTTCCTGGAAGACACTGTGAGG + Intergenic
1150127133 17:62644703-62644725 CCTTCCAGGGAGGCTCTGACTGG - Intronic
1151146432 17:72045955-72045977 TCTTCCAGGCTGACCTTGTCTGG + Intergenic
1154383127 18:13870214-13870236 CCTTCCTGTCAGCCTCTGTCTGG + Intergenic
1157818802 18:50750588-50750610 CCTTGCAGGCAGACAGTCCCAGG - Intergenic
1158558949 18:58497975-58497997 CCTTCCAGGCAGACACTGTCAGG - Intronic
1160239206 18:77111106-77111128 CCTCCCAGGCAAACATTGCCAGG - Intronic
1160931124 19:1569865-1569887 TCTTCCAGGCAGGCAGGGTCAGG + Intergenic
1161219647 19:3112544-3112566 CCTTTGGGGCAGACACTGTGGGG - Intronic
1162142868 19:8595319-8595341 CCTTCCAGGGACTCCCTGTCTGG - Intronic
1163028193 19:14526313-14526335 CCCTACAGACAGGCACTGTCAGG + Intronic
1165362349 19:35344759-35344781 CCTTCCAGGCAAAGGCTGCCAGG + Intronic
1167713199 19:51124809-51124831 CTTTACACCCAGACACTGTCAGG - Intergenic
925495928 2:4449018-4449040 TCTTTCAGGTGGACACTGTCAGG - Intergenic
926196729 2:10768545-10768567 CCTTCCAGGGAGCCCCTGTGTGG - Intronic
927956499 2:27211275-27211297 ACTTCCAGGCAGACACCATGGGG + Intronic
928601819 2:32910883-32910905 TCTTCCAGGCTGACTCTGGCTGG + Intergenic
931808572 2:65831743-65831765 TATTTCAGGCAGACACTGTAAGG + Intergenic
932354507 2:71058146-71058168 CCTTGCAGGTATCCACTGTCAGG + Intergenic
932463373 2:71897554-71897576 CCTTCCACCCAAAAACTGTCGGG + Intergenic
933556189 2:83834148-83834170 CTCTCCAGGTAGAGACTGTCAGG + Intergenic
938424914 2:131178495-131178517 CCATCCAGGAAAACACTGGCTGG + Intronic
939714716 2:145569761-145569783 TCTTACAGGCAGACAGTTTCTGG + Intergenic
942709097 2:178812450-178812472 CCTGCCAGGCAGGAACTGTGTGG - Intronic
948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG + Intergenic
948943426 2:241207566-241207588 CCTTGCAGGCAGGAACTGTGTGG + Exonic
1171233904 20:23509201-23509223 CTTTTCAGGCAGGCAGTGTCTGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173362958 20:42360815-42360837 CCTTTCTGGCAGACACCGCCTGG + Intronic
1173938577 20:46890545-46890567 GCTTCCAGGCAGCCACTGCAAGG - Intergenic
1174174341 20:48635582-48635604 CCAGCCAGGCAGACAGTGTGAGG - Intronic
1174352667 20:49979553-49979575 ACTTGCAGGCAGCCACTGCCTGG - Intergenic
1174536323 20:51254252-51254274 CCATCAAGGCAGACGCTGTGGGG - Intergenic
1176430063 21:6569955-6569977 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1178602031 21:34002833-34002855 CCTTCCAGGCAGTGGCTTTCAGG - Intergenic
1178944983 21:36939582-36939604 CCTTACAGGGAGGAACTGTCTGG - Intronic
1179705457 21:43177417-43177439 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1179716486 21:43291277-43291299 CTTTCCAGGGGGACACTGCCTGG - Intergenic
1180075294 21:45458810-45458832 CCTGCCAGCCCGAGACTGTCTGG + Intronic
1180466071 22:15612644-15612666 CCATCCAGGAAAACACTGGCTGG + Intergenic
1180946578 22:19697122-19697144 CATTCCAGGCAGACAGTGGCTGG - Intergenic
1182129520 22:27840665-27840687 CCTTCCACCCTGACCCTGTCCGG - Intergenic
1184513752 22:44947626-44947648 CCTTCCACGCGGACCCTGTGGGG + Intronic
1184864832 22:47196298-47196320 CCTTCCACCCAGACACTGAGAGG - Intergenic
950642680 3:14358685-14358707 CCTTCCAGGTAGGCCCTGCCAGG - Intergenic
951782084 3:26375039-26375061 GCTTTTAGGCAGACACTGTGGGG - Intergenic
954413719 3:50382721-50382743 CCTGCCAGGCAGACTCTCTCAGG - Intronic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
955015182 3:55063339-55063361 CCTTCAAGGCTGAGACTGTCTGG - Intronic
955141912 3:56277952-56277974 CCTTACAGGAAGTCACAGTCAGG - Intronic
956024411 3:64967413-64967435 CCTTCCAGGCAGCATCGGTCAGG - Intergenic
956965593 3:74455768-74455790 GCTTCCAGGCAAACAGGGTCTGG - Intronic
961889604 3:130119740-130119762 CCTTCCAGGCAGGCTGTGTGGGG - Intergenic
962021636 3:131508367-131508389 TCTTCCAGGTAAACACTGTTAGG - Intergenic
962357674 3:134708872-134708894 CCTTCCAGACACACACTCACAGG - Intronic
962373346 3:134839630-134839652 CCTGCCAGGCTGACTCTGACTGG + Intronic
963079265 3:141376103-141376125 CCGGGCAGTCAGACACTGTCAGG - Intronic
963601901 3:147385767-147385789 CTTTCCTGGCAGACACTGAGAGG + Intergenic
964713626 3:159698234-159698256 CATTGCTGGCAGACACTGTTTGG - Intronic
965776345 3:172235708-172235730 CCTTCCCTGCAGAGATTGTCTGG + Intronic
966931549 3:184678809-184678831 CCTCTCTGGCAGACACTGTGGGG + Intronic
967121598 3:186387177-186387199 CCATCCAGGCAGGGACTGCCTGG - Intergenic
967953000 3:194855120-194855142 CCAGACAGACAGACACTGTCAGG + Intergenic
968357555 3:198121010-198121032 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
968443026 4:634081-634103 CCTCCCAGGCACACACTCCCAGG - Intronic
968706653 4:2081465-2081487 CCTGCCTGGCAGTTACTGTCAGG - Intronic
968817990 4:2831630-2831652 CCTCACAGGCTGACACTGGCGGG + Exonic
968867554 4:3223398-3223420 CCTTCCAGGAAGACACAGAGAGG + Exonic
969641800 4:8403290-8403312 ACATCCAGGCAGAAACTGGCTGG + Intronic
971862426 4:32125178-32125200 CCTTGCAGTTAGTCACTGTCTGG - Intergenic
973153919 4:46924449-46924471 CCTTGCAGGTAGTCACAGTCCGG - Exonic
975192055 4:71475946-71475968 CCTTCTAGGCATACATTGTAGGG + Intronic
975448051 4:74490663-74490685 CCTCCCAGACAGGCCCTGTCAGG + Intergenic
975729777 4:77326888-77326910 CCTCCCAGGCAAACAGGGTCTGG - Intronic
975985472 4:80197975-80197997 CCCTCTAGGCAGGCATTGTCTGG - Intronic
979424101 4:120543929-120543951 CCTTCCATCCATACACTCTCAGG + Intergenic
980084736 4:128379648-128379670 CCTACAAAGCAGACAATGTCAGG + Intergenic
980807456 4:137831821-137831843 CCTTCCTGGCAGAGTCTGCCAGG + Intergenic
980901386 4:138908492-138908514 CCTTCCATGCAGGCATTGTGAGG + Intergenic
983971661 4:173882886-173882908 CGTTCCAGGCAGAGACTGTAAGG + Intergenic
984531313 4:180920008-180920030 CCTTGAAGGCAGAGAATGTCTGG - Intergenic
984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG + Intergenic
985490430 5:175616-175638 CCCTCCAGGCAGACACGACCAGG + Intronic
985490447 5:175675-175697 CCCTCCAGGCAGACACGACCAGG + Intronic
985490464 5:175734-175756 CCCTCCAGGCAGACACGACCAGG + Intronic
985490481 5:175793-175815 CCCTCCAGGCAGACACGACCAGG + Intronic
985490498 5:175852-175874 CCCTCCAGGCAGACACGACCAGG + Intronic
985490514 5:175910-175932 CCCTCCAGGCAGACACGACCAGG + Intronic
985490530 5:175968-175990 CCCTCCAGGCAGACACGACCAGG + Intronic
985713997 5:1445688-1445710 CCTTCCACGCGGGAACTGTCTGG + Intergenic
985885774 5:2676559-2676581 CCGTCCAGGCAGTCATTCTCAGG + Intergenic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
993670630 5:90757096-90757118 TCTTCCAGGCCAGCACTGTCTGG - Exonic
994362782 5:98873369-98873391 CCTCCCAGACAGAAAATGTCAGG + Intronic
995835994 5:116399969-116399991 CCCTTCAGGCAGTGACTGTCAGG + Intronic
997161662 5:131615483-131615505 ACTTCCAGTCTGACTCTGTCAGG - Intronic
997280671 5:132642580-132642602 CATTCCAGGCAGCCTCTGTCAGG + Exonic
998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG + Intergenic
999194221 5:149771203-149771225 CCCTGCAGGCAGCCACTGCCTGG + Intronic
1001146819 5:169192180-169192202 CCATCCAGGCAGACCCAGACTGG + Intronic
1001564526 5:172690836-172690858 CCTGCCAGGGAGACACAGTGAGG + Exonic
1001612705 5:173016243-173016265 ACCTCCAGGCAGATAATGTCAGG + Intronic
1002605747 5:180381779-180381801 CCCTCCCTGCTGACACTGTCTGG + Intergenic
1004231662 6:13839260-13839282 CTTTCCAGAAATACACTGTCTGG + Intergenic
1005142043 6:22643582-22643604 ACTTCTATGCAGACACTTTCAGG + Intergenic
1005908744 6:30289117-30289139 TCTGCCAGACTGACACTGTCTGG - Intergenic
1010048208 6:71471999-71472021 CTTTCCAGGAAGACAATGTTAGG + Intergenic
1010716654 6:79238039-79238061 TCTTTCAGGCAGACACAGGCAGG + Intergenic
1016396051 6:143624634-143624656 CCATCCAAGCAGACACAGGCTGG - Intronic
1018577666 6:165276554-165276576 CCTATCAAGAAGACACTGTCGGG + Intergenic
1018787721 6:167121360-167121382 CTTTCCAGGCAGGCATTGCCAGG + Intergenic
1021519450 7:21524674-21524696 CTTTGAAGGCAGACACTATCAGG - Intergenic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1032448135 7:132002346-132002368 ACTTCCATGCAGACACTTTAAGG - Intergenic
1032600847 7:133292578-133292600 CTTTCCAGGCAGACAGTATTGGG - Intronic
1032739887 7:134728664-134728686 CTTTCCAGTCAGATACTCTCTGG - Intergenic
1040275944 8:46013716-46013738 CCTTCCCGGCAGGCACTGCGTGG - Intergenic
1044526075 8:93252631-93252653 CCATCCAGGCAGAGATTGTGGGG - Intergenic
1047529167 8:125659675-125659697 CCTTCCAGGCAGGAACTTTAAGG + Intergenic
1049818406 8:144619214-144619236 CTTTCCCAGCAGACCCTGTCTGG - Intergenic
1054443168 9:65284671-65284693 TCTTCTGGGCAAACACTGTCCGG + Exonic
1054487112 9:65736830-65736852 TCTTCTGGGCAAACACTGTCCGG - Exonic
1055482843 9:76726875-76726897 CCTTCCAGGCAGAGAATACCTGG + Intronic
1055599774 9:77903575-77903597 CCTTCCAGGCAGGCTCTATCTGG + Intronic
1056886076 9:90445299-90445321 CCTTCTGGGCAGACACACTCTGG - Intergenic
1058423557 9:104856537-104856559 CCTCCCAGAGAGATACTGTCAGG + Intronic
1059595407 9:115714884-115714906 CATTCCAATTAGACACTGTCTGG - Intergenic
1059948491 9:119437726-119437748 CCTTCCAAGCCTACAGTGTCAGG + Intergenic
1062534138 9:137014167-137014189 CCTTGCAGGCTGACATTGTCTGG + Exonic
1062741403 9:138177500-138177522 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
1186179929 X:6963461-6963483 AACTCCAGGCAGACAGTGTCAGG + Intergenic
1186230621 X:7449836-7449858 CCTTCCAGGCATACCCAGCCTGG + Intergenic
1187229283 X:17405359-17405381 CATTCCAGGCAGGCACTAACTGG - Intronic
1193358908 X:80556828-80556850 CCCTCCATTCAGACACTTTCAGG - Intergenic
1194183654 X:90744504-90744526 CCTTAGAGGAAGTCACTGTCAGG - Intergenic
1198638963 X:138734789-138734811 CCTTCCAGGAAGGCACAGGCTGG - Intronic
1200096327 X:153665807-153665829 TCTTCCTGCCAGGCACTGTCTGG - Intergenic
1200530261 Y:4326453-4326475 CCTTAGAGGAAGTCACTGTCAGG - Intergenic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic