ID: 1158565289

View in Genome Browser
Species Human (GRCh38)
Location 18:58549856-58549878
Sequence CTGTGTCCTGAAAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158565282_1158565289 10 Left 1158565282 18:58549823-58549845 CCCTGCATGGGTAGGTGGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1158565289 18:58549856-58549878 CTGTGTCCTGAAAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 38
4: 336
1158565284_1158565289 9 Left 1158565284 18:58549824-58549846 CCTGCATGGGTAGGTGGAAGGGT 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1158565289 18:58549856-58549878 CTGTGTCCTGAAAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 38
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158565289 Original CRISPR CTGTGTCCTGAAAGGGAAGC AGG Intronic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
900703109 1:4060253-4060275 CTTTGATCTGAAAGGGAAACAGG - Intergenic
900716365 1:4147618-4147640 CTGTGTCTTGACATGGAAGGCGG + Intergenic
901226564 1:7616538-7616560 CAGAGTGCTGAAAAGGAAGCCGG + Intronic
901449028 1:9325029-9325051 CTGCCTCCTGAATGGGCAGCCGG + Intronic
901672615 1:10865099-10865121 CTGTAGCCTGCAAGGGGAGCAGG + Intergenic
901877640 1:12175838-12175860 CTGAGCCCTGAAAGGTAGGCGGG + Intronic
903406039 1:23097093-23097115 CTGTTTCCTCACAGGGAAGAAGG + Intronic
904407510 1:30302650-30302672 CTGTGTCCTCATAGGGGAGGGGG - Intergenic
905058678 1:35121052-35121074 CTCTGTCCTGAAAGTGAAAGGGG - Intergenic
906343476 1:45001177-45001199 CTGCTTCCTGGAAGGGAAGGGGG + Intergenic
907496821 1:54850948-54850970 TTGCGTCATGTAAGGGAAGCTGG - Exonic
908672077 1:66559090-66559112 TTGAGCCCTGGAAGGGAAGCAGG - Intronic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
909347798 1:74612735-74612757 CTTTTTCCTGAATGGGATGCAGG - Exonic
909903785 1:81171794-81171816 CTGTATCCTTAAAGGTAGGCTGG + Intergenic
909949501 1:81703231-81703253 CTGTACCCAGAAAGTGAAGCGGG + Intronic
910436635 1:87212112-87212134 CCATGTCCTGCAAGGGAAGGAGG - Intergenic
911165781 1:94723415-94723437 CAGTGTCCTGAACATGAAGCAGG - Intergenic
911748970 1:101473819-101473841 GTGTGTGCTGTATGGGAAGCTGG + Intergenic
912382424 1:109254670-109254692 GTGTGGCCTGAAGGGGAAGGAGG + Intronic
912705220 1:111906611-111906633 CAGTGTCCTGAGAGAGAACCAGG - Intronic
915117026 1:153607686-153607708 CTGTGTCCTGGGGAGGAAGCAGG + Exonic
916074232 1:161191105-161191127 CGGTGCCCAGAAAGGGCAGCCGG + Exonic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
919454628 1:197806588-197806610 CTGTGTCCTCACATGGCAGCAGG + Intergenic
920649770 1:207828237-207828259 CTGTGTCTTGAATGGGCAGCTGG - Intergenic
920651732 1:207842659-207842681 CTGAGTGCTAAAAGGGAATCCGG - Intergenic
921789101 1:219269178-219269200 CTGTGTCCTACAAGTGAAGATGG + Intergenic
922218205 1:223538133-223538155 CTGTGTCCTGGAAGGGTAGAAGG + Intronic
922819108 1:228471616-228471638 CTGTGTCCTCCAAAGGAGGCTGG + Intergenic
923319529 1:232816939-232816961 CTGTGTCCTTACATGGAAGAAGG + Intergenic
923452813 1:234135755-234135777 CAGACTCCTGAAAGGAAAGCAGG + Intronic
1062927018 10:1324790-1324812 CTGTGTCCTGACAGTGCAGGTGG + Intronic
1063343948 10:5294242-5294264 CTGAGAGCAGAAAGGGAAGCTGG - Intergenic
1067386266 10:45819836-45819858 CTGTATCCGGGAAAGGAAGCTGG + Intergenic
1067829183 10:49600306-49600328 CTGGGACCTGGAAAGGAAGCTGG - Intergenic
1067896320 10:50183910-50183932 CTCTTACCTGCAAGGGAAGCTGG - Exonic
1067952657 10:50758117-50758139 CTCTTACCTGCAAGGGAAGCTGG + Intronic
1069544155 10:69317374-69317396 CTGTGACCTGGACAGGAAGCTGG + Intronic
1070332644 10:75429403-75429425 CTGTGTCCTCAAATGGTAGGAGG - Intergenic
1071124738 10:82320780-82320802 CTGTGGCCTTAAATGGGAGCTGG + Intronic
1071233577 10:83617989-83618011 CATTTTCCTGAAATGGAAGCAGG + Intergenic
1072087290 10:92093193-92093215 CTGGGTGCAGAAAGGGAACCTGG + Intronic
1072205838 10:93204700-93204722 ATGGGGCCTGAGAGGGAAGCTGG + Intergenic
1072418358 10:95268551-95268573 CTGTGTCCTGGGCTGGAAGCAGG - Intronic
1072543030 10:96412914-96412936 TTGTGTCCAGAAGGGGAAGAAGG - Intronic
1072912826 10:99519359-99519381 CTGTGTCCTGAAAGTGACTTTGG + Intergenic
1073109193 10:101050663-101050685 CTGTTTCCTGTAAAGGAACCTGG + Intergenic
1073875476 10:107916905-107916927 CAGTGTCCTAAATGGTAAGCTGG + Intergenic
1074125458 10:110525580-110525602 CTCAGTCCTGACAGGGAAGGAGG - Intergenic
1075125784 10:119697862-119697884 GTGTGTCCTTAAAGGGAGGGAGG + Intergenic
1076002562 10:126923860-126923882 CTGTGTCCTCACAGGGTAGAAGG - Intronic
1076426627 10:130371708-130371730 CTGTGACAGGAAAGGGAAGCTGG + Intergenic
1077523401 11:3049685-3049707 CTGTGCCCAGGAAGGGCAGCTGG - Intronic
1078859912 11:15237482-15237504 CTGTTTCCTGAAAGAGCAGGGGG - Intronic
1080142720 11:28942035-28942057 CTGTCCCCTGCAAGTGAAGCAGG - Intergenic
1080329230 11:31116003-31116025 CTCAGTCCTGAGAGGGAATCTGG + Intronic
1080738500 11:35041162-35041184 ATGTGTGCTTAAAGGGAAGTGGG + Intergenic
1081757604 11:45555793-45555815 CTGTGTCTTGGAAGGGTAGAGGG + Intergenic
1083740107 11:64705229-64705251 CTGCCTCCTGAAAGGAGAGCTGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085309014 11:75505302-75505324 CTGGATCCTGAGAGGGAGGCAGG - Intronic
1085404766 11:76255256-76255278 CTGTGTCCCGAAGGGGAATAGGG - Intergenic
1085765714 11:79279986-79280008 CTGTGTCCTCAAATGGCAGAGGG - Intronic
1087652119 11:100879942-100879964 CTGTGTGTTGAAAGGGATGAGGG - Intronic
1088994294 11:114983013-114983035 CTGTGTCCAGAATGGCAGGCAGG - Intergenic
1089611499 11:119672030-119672052 CAGTGTCCTGGAAGGGAGGCAGG - Intronic
1089662237 11:119993156-119993178 CTGTGTCCTGTGAGGTGAGCAGG - Intergenic
1091142082 11:133244007-133244029 CTCTGTCCTGAAAGGCAGGCAGG - Intronic
1091602896 12:1928704-1928726 CTGTTTCCAGAGAGGGAACCGGG - Intergenic
1092126174 12:6076655-6076677 CTGGGTCCTGAAGGGTAAACTGG + Intronic
1094344785 12:29455303-29455325 CTGTGTCCAGCCATGGAAGCCGG - Exonic
1095401657 12:41821113-41821135 CTCTGCCCTGAAAGAGAAGAAGG + Intergenic
1095750503 12:45705383-45705405 ATGTGTCTTGAAAAGGAAGAGGG - Intergenic
1095980270 12:47969071-47969093 CTCTGTCCTGGAAGGGAACAGGG - Intergenic
1096154019 12:49331870-49331892 CTGAATCCTGAAAGGGAAGGAGG + Intergenic
1096812932 12:54183172-54183194 CTGAGCCCTGAAAGAAAAGCGGG + Intronic
1096849527 12:54426794-54426816 CTGGGTCCTAAATGGGAAGCTGG - Intergenic
1102426218 12:112846405-112846427 TTGTTTCCAGAAAGGGAAGGAGG - Intronic
1106933478 13:34692535-34692557 CTGTGTCCTCACAAGGAGGCAGG + Intergenic
1107088797 13:36453676-36453698 CTGTGTGGTTAAAAGGAAGCAGG - Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1108077069 13:46692268-46692290 CTGTTTCTTGAACTGGAAGCTGG - Intronic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109421664 13:62120539-62120561 GTGAGTCCTGAAAAGGAAGAAGG - Intergenic
1109756747 13:66770957-66770979 CTGAGTCCTGAAAGGTATGTAGG - Intronic
1110136504 13:72073777-72073799 CTGTATCCTCACATGGAAGCGGG - Intergenic
1110454774 13:75679092-75679114 CTGTGTCATGAAAAGAAAGGGGG - Intronic
1110471055 13:75860894-75860916 GTGTGTTCTGAAGGTGAAGCTGG + Intergenic
1113108042 13:106792184-106792206 CTCTGTCCTGAGATGGCAGCTGG + Intergenic
1113156605 13:107329941-107329963 CTATGACCTGAAATGAAAGCAGG - Intronic
1113464077 13:110501771-110501793 ATTTGGCCTGAAAGGTAAGCAGG + Exonic
1113654249 13:112058117-112058139 CTGTTTCCTGCAAGGGGAGGCGG - Intergenic
1113788040 13:113013054-113013076 CTGTGACCTGAGAGGAAACCAGG - Intronic
1114080089 14:19196271-19196293 CTGAATTCTGAAAGGGAAGAGGG - Intergenic
1115079668 14:29435736-29435758 CTGTATACTCATAGGGAAGCTGG - Intergenic
1115823434 14:37237064-37237086 CTATGGCCTGAAAGAGAAGCTGG - Intronic
1116110528 14:40574868-40574890 GGGTGTCCTGAAAGAGAAGTTGG - Intergenic
1117116100 14:52514238-52514260 CTGTTTCCTGAGAGGTCAGCAGG + Intronic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117714453 14:58566458-58566480 CTATGTCCTGAGATAGAAGCTGG - Intergenic
1119194650 14:72708473-72708495 CTTTGTCGCGGAAGGGAAGCTGG - Intronic
1119949198 14:78727229-78727251 CTGTGTTCTGAAAGGAATGATGG + Intronic
1120242836 14:81969934-81969956 GTGTGTCCTGAAAGAGAAAGCGG - Intergenic
1120974155 14:90234410-90234432 CTGAGACCTGAAAGTTAAGCAGG + Intergenic
1121931552 14:97977059-97977081 CTTTGTCCTGGAGTGGAAGCAGG - Intronic
1122535197 14:102457049-102457071 CTGTGTCCTGCAGGAAAAGCAGG + Intronic
1124446050 15:29733702-29733724 CTGTGTACTGAAAGGGTAAGGGG + Intronic
1124585863 15:31006044-31006066 CTCTGTGCTGAAAGGAAAGCTGG - Intronic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1128301402 15:66568275-66568297 CTGTGTCCTCAGGGGTAAGCAGG + Intergenic
1128679568 15:69638220-69638242 GTGAGTCCTGAAAGGAAAGAGGG + Intergenic
1128951661 15:71890470-71890492 CTGTCTTCTGAATGGTAAGCGGG - Intronic
1129342669 15:74896372-74896394 CTTTGTCCAGATAGGGAAACAGG - Intronic
1129504332 15:76068643-76068665 CTGTGTCCTCACATGGAAGCAGG - Intronic
1129538398 15:76332606-76332628 CTGTTTGCTCAAAGGGAATCTGG + Intergenic
1129797736 15:78390939-78390961 CTGGCTCTTGAAAGAGAAGCTGG + Intergenic
1131060022 15:89398944-89398966 CTGTGACCAGAATGGGATGCAGG + Intergenic
1131622132 15:94079584-94079606 CTGTGTCCTGACAGAAAGGCAGG - Intergenic
1131734644 15:95319143-95319165 ATGTGTCATGAAAGGAAAGGTGG + Intergenic
1132158785 15:99517477-99517499 CTGTGTCATGAAATGTAATCAGG + Intergenic
1132764086 16:1525669-1525691 CTGTCTCCTGCCTGGGAAGCTGG + Intronic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133223379 16:4328633-4328655 CTGGGTCCTGCCAGGGAGGCAGG - Intronic
1134215239 16:12312079-12312101 CTCTGAGCTGCAAGGGAAGCTGG + Intronic
1134310229 16:13069848-13069870 CTGTGTCCTCACAGGGCAGAAGG - Intronic
1135515910 16:23133585-23133607 CTGTTCCCTCAAAGGGTAGCAGG - Intronic
1136605221 16:31329321-31329343 CTGGGTCCTGAGAAGGAGGCTGG + Intronic
1138281651 16:55776509-55776531 ATGTGTCATGAAAGGCAAGGTGG - Intergenic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138513998 16:57525986-57526008 CTGTGTCCTCCCAGGGTAGCCGG + Exonic
1139485860 16:67256253-67256275 GTGTCTCCTGGAAGGGAAGGTGG - Intronic
1139966403 16:70747890-70747912 CTCTGTTCTGACAGGGAAGTAGG - Intronic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1141854491 16:86671857-86671879 CTGTTTCCTGAAAAGGATGGTGG - Intergenic
1143127432 17:4652480-4652502 CTGTCTCCTGTAAGGCAAGGGGG - Intergenic
1143454339 17:7056416-7056438 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
1144050236 17:11491741-11491763 TTGTGTACTGAAAGGGAAGCTGG + Intronic
1144321184 17:14121894-14121916 CTGAGCCCAGAGAGGGAAGCTGG + Intronic
1145941374 17:28744935-28744957 CTGCGTCCTGAGAGGGCAGCGGG - Intronic
1146064870 17:29626461-29626483 CTGTGTCCTCAAAGCAATGCTGG - Exonic
1147450242 17:40499823-40499845 CTGTGTCCTGCAGAGGAGGCTGG + Intronic
1148291804 17:46458480-46458502 CTGGGTTCTGGAATGGAAGCTGG + Intergenic
1148313994 17:46676185-46676207 CTGGGTTCTGGAATGGAAGCTGG + Intronic
1148344794 17:46895927-46895949 CAGGGTCTTGAAGGGGAAGCTGG + Intergenic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1150654383 17:67030450-67030472 CTGAGGCCTGAAAGGGAAGCGGG - Exonic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1152690568 17:81715993-81716015 CTGCATCCTGAAACAGAAGCAGG - Exonic
1153943484 18:9997095-9997117 CAGTTTCCTGAGAGGGAAGCTGG - Intergenic
1154982328 18:21513490-21513512 CTTTGTCCTGTGAGGGAAACTGG + Intronic
1155095206 18:22548842-22548864 TTGTTTCCTGAGAAGGAAGCTGG - Intergenic
1155682153 18:28501490-28501512 TTGATTCCTGAAAGGGAATCTGG + Intergenic
1155964094 18:32019596-32019618 CTGTGTTGGGAAAGGGTAGCAGG - Intronic
1156370393 18:36467472-36467494 CTCTGCCCTGGAAGGGAAGAAGG - Intronic
1156950687 18:42893421-42893443 CTGTGTCCTCAAAAGGCAGAAGG + Intronic
1157336168 18:46739135-46739157 CTGAGACCAGAAAGAGAAGCAGG + Intronic
1157801365 18:50623970-50623992 CTGAGACCTGAAAGGTAAGAAGG - Intronic
1157963174 18:52179438-52179460 CTCAGTCCTGAAAGGGGACCTGG + Intergenic
1158565289 18:58549856-58549878 CTGTGTCCTGAAAGGGAAGCAGG + Intronic
1158638182 18:59179607-59179629 CTGTGTCCTCACAGGGTAGAAGG + Intergenic
1158679814 18:59557156-59557178 CTGTGACATGCATGGGAAGCTGG - Intronic
1158828096 18:61246974-61246996 TTGGGTCCTGAATGGGAATCAGG + Intergenic
1159583447 18:70260889-70260911 GGGTGTCCTGCAGGGGAAGCTGG + Intergenic
1160224252 18:76999757-76999779 GTGTGTCCTAAAAAGTAAGCAGG - Intronic
1162466772 19:10846900-10846922 CTGAGACCTGAAGGAGAAGCAGG + Intronic
1163497867 19:17657084-17657106 CTGTGGCTTCCAAGGGAAGCAGG - Intronic
1164421665 19:28099025-28099047 CTGAGTCCAGAAAGAAAAGCAGG + Intergenic
1164512636 19:28910124-28910146 CTGTGTCCGGCAAGAGGAGCAGG - Intergenic
1164703590 19:30303462-30303484 TTGTTTCCTGAAAGGGAATCAGG + Intronic
1165896809 19:39146369-39146391 CTGAGGCCTGAAAGAGGAGCAGG + Intronic
1166051528 19:40263634-40263656 CTCTGTCCAGAAAGAGCAGCAGG + Intronic
1167114655 19:47481814-47481836 CTGTGTTCTGGAATGGAATCTGG + Intronic
1167422540 19:49412696-49412718 CTGGGTCCTGTCAGGGAAGGGGG + Intronic
1168413180 19:56152761-56152783 CTGTGTCCTCACAGGGCAGAAGG + Intronic
925584495 2:5450741-5450763 CTGTGTCCTCATAGGGTAGAAGG + Intergenic
925598902 2:5588195-5588217 CTGCATCCAGAAAGGGAAGCCGG + Intergenic
925648844 2:6067299-6067321 CTGTGTCCTGAAAGGACATCAGG - Intergenic
925648848 2:6067328-6067350 CTGTGTCCTGAAAGGACATCAGG - Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
926949416 2:18225783-18225805 GTGTGTCCTGGAAGCAAAGCAGG - Intronic
927990465 2:27443382-27443404 CTGTATCCTGAAAAGCAAGAAGG - Exonic
928072220 2:28228303-28228325 CTGTGTCCTGGAAAGGCAGAAGG + Intronic
928809469 2:35205082-35205104 TTATGTACTGAAAGGGAAACTGG + Intergenic
929825245 2:45305053-45305075 CTGTGACCTGCAAGGGAGGCTGG + Intergenic
930253703 2:49064894-49064916 CTGGTCCCTGAATGGGAAGCAGG + Intronic
930561823 2:52968956-52968978 TTGTGTCCTTAAAAGAAAGCAGG - Intergenic
933684337 2:85131711-85131733 CTGTGTCCTGAGGGGGAAAGAGG + Intergenic
936579031 2:113680008-113680030 ATGTGTCCTGAAAGAGAAATGGG - Intergenic
937283071 2:120733832-120733854 CTGTGTTCTGAAAGCTCAGCAGG + Intergenic
937318517 2:120947201-120947223 CTGTGCCCTGGCAGGGAAGTGGG - Intronic
937496565 2:122426410-122426432 CTGTGTCCTCACAGGCAAGAAGG - Intergenic
938786246 2:134632621-134632643 CTGTGTCCTCAAAGGGTGGAAGG + Intronic
939903394 2:147879305-147879327 CTGTGTCCTCACAGGGCAGAGGG + Intronic
940285564 2:152029787-152029809 CTGTGTCCTCAAATGGTAGAAGG - Intronic
940353940 2:152718389-152718411 CTGTAGCCGGAAAGGGGAGCAGG - Exonic
940637116 2:156310947-156310969 CTGTGGCATCCAAGGGAAGCAGG + Intergenic
940839072 2:158558670-158558692 GTGTGTCTGGAAAGGGAAACAGG + Intronic
941540760 2:166781475-166781497 CTGTGTCCTGAGCTAGAAGCAGG + Intergenic
941642681 2:168006025-168006047 CTGTTTCCTGAGAAGGGAGCTGG - Intronic
943235760 2:185317203-185317225 CTGTCTACTGAAAGAGAGGCTGG - Intergenic
943473688 2:188328301-188328323 CATTTTCCTGAAAGGGAAGATGG - Intronic
945193563 2:207216108-207216130 GTGTGTGAAGAAAGGGAAGCAGG + Intergenic
945965638 2:216183652-216183674 TTCTGTTCTGAAAGGGAAGCAGG + Intronic
946964753 2:225026049-225026071 TTGGGTCTTGAAAGGCAAGCAGG + Intronic
947509425 2:230737376-230737398 AGGTGTCCTGAGAGGGTAGCGGG - Intronic
947872796 2:233449105-233449127 CTCTGTCCTGAAAGAGAAGCTGG + Exonic
948221798 2:236275831-236275853 CTGTGTCCTGACATGGCAGAAGG - Intergenic
948644981 2:239398857-239398879 CTTTCTCCTGCAAGGGGAGCTGG - Intronic
948921970 2:241070059-241070081 CTATGTCCCCAACGGGAAGCTGG + Exonic
1168761871 20:354830-354852 CTGTTTATTGAAAGGGAAGGTGG - Exonic
1169725542 20:8725133-8725155 CTGTTTCCCAGAAGGGAAGCAGG + Intronic
1170742967 20:19073846-19073868 CTGAGACCTAAAAGGGAGGCAGG + Intergenic
1172150807 20:32789062-32789084 CTTTGTCTTCAAAGGGAGGCAGG - Intronic
1173398452 20:42702625-42702647 CTGTGTCCTGTAATGAATGCAGG + Intronic
1174148262 20:48467754-48467776 CTGTTTGCTGCAAGGGATGCTGG - Intergenic
1174439410 20:50537779-50537801 CTGGGTGCTGAAAGGTATGCTGG + Intronic
1176216244 20:63949314-63949336 CGGTGCCCTGAAGGGGGAGCAGG + Intronic
1178328337 21:31663586-31663608 CTGTGTCCTCAAAAGGGAGATGG - Intronic
1179131496 21:38641290-38641312 CTGTGTCCTCAAATGGTAGAAGG - Intronic
1179481128 21:41679312-41679334 CCGTCTCCTGAAGGGGAAGCGGG + Intergenic
1180500685 22:15926429-15926451 CTGAATTCTGAAAGGGAAGAGGG + Intergenic
1180539937 22:16435356-16435378 TCGTTTCCAGAAAGGGAAGCTGG - Intergenic
1181364375 22:22363850-22363872 CTGTGTCCTCACAGGGAACCAGG + Intergenic
1181370852 22:22415646-22415668 CTGTGTCCTCACAGGAAAGCTGG + Intergenic
1181571640 22:23771164-23771186 CTGGGCCAAGAAAGGGAAGCGGG - Intronic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1182130009 22:27843880-27843902 CTGTGTCCTGAAATCAAAGATGG + Intergenic
1183067749 22:35375119-35375141 CTGAATCATGAAAGGGGAGCTGG + Intergenic
1183237625 22:36631422-36631444 CAGTGTCCTTCAGGGGAAGCTGG + Intronic
1184039217 22:41933388-41933410 CTGTGTCCTCACAGGGAGGCTGG + Intergenic
1184770803 22:46595447-46595469 CTGTGTCTGGAAAGGGGAGGTGG + Intronic
1184922784 22:47617043-47617065 CTGTGGCCTGATTTGGAAGCAGG - Intergenic
1185087394 22:48748371-48748393 CTGGGGCCTGGAAAGGAAGCTGG - Intronic
949484001 3:4519967-4519989 CTGAGTCCTGAAAGACAGGCAGG + Intronic
953420778 3:42751669-42751691 CTGTCTCCAGAAAGGAAGGCTGG - Intronic
954843311 3:53532245-53532267 CTGTGTCCTGCAGGGGGATCTGG + Intronic
957674656 3:83350979-83351001 CTGGGTCTTGAAAGGGTTGCAGG - Intergenic
959230188 3:103639036-103639058 CTGTGTCCTGAAACATAAACAGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
961522618 3:127475680-127475702 CTTTGTCCTTGGAGGGAAGCTGG + Intergenic
963847379 3:150172859-150172881 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
964447401 3:156774460-156774482 CTGTGTACTCAAAGAGAAGCTGG + Intergenic
964492870 3:157255589-157255611 TCCTTTCCTGAAAGGGAAGCTGG - Intergenic
966935476 3:184705769-184705791 CTGTGTTCTGTAAGGGAGACAGG - Intergenic
968497259 4:925713-925735 CTGTGTCCTCACAGGGCAGAAGG - Intronic
969474911 4:7416343-7416365 CTGTGTCCTGGAGGGCAAGGAGG - Intronic
969627460 4:8314853-8314875 CTCTGTCCTGAAAGAGAAGCTGG + Intergenic
970042947 4:11817262-11817284 CTCTGTCATCACAGGGAAGCTGG + Intergenic
970142662 4:12998908-12998930 CTCTGTTCTGAAAAGGCAGCAGG + Intergenic
970243704 4:14036056-14036078 CAGTGTCCAGAAAGAGAAGGTGG - Intergenic
972263601 4:37437309-37437331 CTGTGTCCTCACAGGGCAGGAGG + Intronic
972273412 4:37534695-37534717 CTGTGTCCTTACAGGGCAGAAGG + Intronic
972602907 4:40588331-40588353 TTGAATCCTGAAAGGGAAACTGG - Intronic
973738132 4:53892560-53892582 CGGTATCCTCAAAGTGAAGCAGG + Intronic
974763099 4:66304907-66304929 GTGAGTCTTGAAAGGGAAGATGG - Intergenic
975523928 4:75328811-75328833 CTGGGTCCTCACAGGGTAGCAGG - Intergenic
976387208 4:84474828-84474850 CTTTTTCCTAAGAGGGAAGCTGG - Intergenic
976434733 4:85004214-85004236 CTGTGTCCTAAAATGGTAGAAGG - Intergenic
977945404 4:102907535-102907557 TCGTTTCCAGAAAGGGAAGCTGG - Intronic
978372504 4:108043084-108043106 CTCAGTGCTGAAAGGGTAGCTGG - Intergenic
978444113 4:108764234-108764256 CTGTGTTTTGAAAGGGCAGCAGG + Intergenic
978789915 4:112651442-112651464 CTGTCTCCTGAAATGCAAGCTGG - Intronic
979978478 4:127225423-127225445 CTGTGTTCTGAAAAGCAAGTAGG - Intergenic
981173628 4:141654277-141654299 CAGATTCCTGGAAGGGAAGCAGG + Intronic
982558299 4:156897523-156897545 CTCTGTCCTGATAGGAAAGGTGG - Intronic
984305414 4:177983193-177983215 CTGTGTCCTCACAGGGCAGAAGG - Intronic
984462232 4:180052835-180052857 CTGCGTCCTGACAGGGTAGAGGG - Intergenic
986285853 5:6358536-6358558 CTGTGTCCCCATAGGAAAGCAGG + Intergenic
987103844 5:14617491-14617513 CTGAGCCCAGAAAGGGCAGCTGG - Intergenic
987557864 5:19478665-19478687 CTGTGGACTGAAAGGGTAGCTGG + Intronic
988441354 5:31237293-31237315 CTGTGTCCTTAAAAGGATGGAGG + Intronic
990468948 5:56095622-56095644 CAGTGTGCTGAAAGTGAACCTGG - Intergenic
990559259 5:56967160-56967182 CTGTGTCCTCAAATGGTAGAAGG - Intronic
990597067 5:57322714-57322736 CTGTTTGCTGAAAGAAAAGCAGG + Intergenic
991257742 5:64633844-64633866 CTTTATCCTGAAAGGCAAGCTGG + Intergenic
992507208 5:77398691-77398713 CTGTGGCCCGGAAGGGCAGCAGG - Intronic
993021904 5:82602114-82602136 CTGTGTCCTCAAATGGCAGAAGG + Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
995828502 5:116328719-116328741 ATGTGTCATGAAGGGGAAACTGG - Intronic
997754679 5:136385193-136385215 AGGTGTCCTGCAGGGGAAGCTGG - Intronic
997887377 5:137642335-137642357 CTGAGACCTGAAAGATAAGCAGG - Intronic
999275653 5:150328404-150328426 ATTGGTCCTGGAAGGGAAGCTGG - Intronic
1000768141 5:165317642-165317664 CTGGTTCCTGAAATGGAAGCAGG - Intergenic
1001696599 5:173674880-173674902 CTCAGTCCTTAAAGGGAAGGAGG + Intergenic
1001941316 5:175741752-175741774 CTGTGCCTTGCAAGGGGAGCAGG + Intergenic
1003692060 6:8364731-8364753 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692068 6:8364779-8364801 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692074 6:8364814-8364836 CTGTGTCCTCATACGGAAGAAGG - Intergenic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1005008253 6:21311593-21311615 CTGGCTCCTGAAACAGAAGCAGG + Intergenic
1005192688 6:23243756-23243778 GTTTTTCCTGAAAGGGAATCTGG - Intergenic
1005672449 6:28120740-28120762 CTGTGCACTAAAGGGGAAGCAGG + Intergenic
1006236616 6:32638896-32638918 ATGGATCCTGAAAGGGAAGAGGG - Intronic
1006246583 6:32742471-32742493 ATGGATCCTGAAAGGGAAGAGGG - Intronic
1007075486 6:39063605-39063627 CTGTGTCTTGAAGGGGGACCTGG + Intronic
1010751568 6:79621401-79621423 CTGTGTCCTCACAGGGTAGAAGG - Intergenic
1011474851 6:87741410-87741432 CTGTGTCTTATAAGAGAAGCAGG + Intergenic
1013482806 6:110566661-110566683 CAGTGCCCTGAGATGGAAGCAGG - Intergenic
1015680873 6:135807217-135807239 CTGTGTAGTGAAAGGGCAGCAGG + Intergenic
1016346076 6:143115853-143115875 CTGTGTCCTGAATGAGGAGAGGG + Intronic
1017169895 6:151447099-151447121 CTGAGTCTTGAAAGGGCAGAAGG + Intronic
1017873794 6:158506950-158506972 CTGTTTCCTGAAAGAACAGCAGG - Exonic
1018071753 6:160170868-160170890 CTATGTCCTGAACTGGAAGTGGG - Intergenic
1018988941 6:168658842-168658864 CTGTGTCCTGCAGGTGATGCAGG - Intronic
1019494079 7:1329516-1329538 CACTGTCCTGACAGGGGAGCTGG + Intergenic
1019592511 7:1842768-1842790 CTGTGTCCTGGAGGGGAGGGTGG + Intronic
1020805137 7:12780453-12780475 CTGGTTCCTGGAAGAGAAGCAGG + Intergenic
1021289036 7:18821099-18821121 CTGTGTCCTTACAGGGTAGAAGG + Intronic
1021915297 7:25425710-25425732 CTGTGGCCCGAAGGGCAAGCTGG - Intergenic
1022790956 7:33688679-33688701 CTGTGTCCTGACATGGTAGAAGG - Intergenic
1023598893 7:41861853-41861875 CTGTTTCCTGAAAAATAAGCTGG + Intergenic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1024262693 7:47583636-47583658 CTTTGTCCTGATAAGGAAACAGG + Intergenic
1025032714 7:55571241-55571263 GTGTTTCCTGAAAGGAAGGCTGG - Intronic
1025974272 7:66357213-66357235 CTGTTTACTGATAAGGAAGCTGG + Intronic
1028446942 7:90935076-90935098 CTGTGTCATCCAAGGGCAGCAGG + Intronic
1030814866 7:114023454-114023476 CTGTGTCCTCAAATGGCAGAAGG + Intronic
1031405126 7:121376092-121376114 CTGTGTTCTGAAAGGCCACCAGG + Intronic
1032836794 7:135682386-135682408 ATGTGTCCTGTAAGGATAGCTGG + Intronic
1032876857 7:136047104-136047126 CTGTGTCCTCACAGGGCAGAAGG + Intergenic
1032879107 7:136069630-136069652 CTGTGTGCTGAAAGAGAGGTCGG - Intergenic
1032932078 7:136684492-136684514 CTGTGTCCTTACATGGAAGAAGG + Intergenic
1033599057 7:142876145-142876167 CTGGGGGCTGAAAGGGAAGGTGG + Intronic
1033817992 7:145098553-145098575 CTGTGTGTTTATAGGGAAGCTGG + Intergenic
1035893578 8:3372535-3372557 CTGTGTCCTGAAGGTAGAGCCGG + Intronic
1036954758 8:13175851-13175873 CTGTGACCAGGAAGGAAAGCAGG - Intronic
1037292085 8:17361495-17361517 CTGTGTTCTAAAAGGAAAGAAGG - Intronic
1038181688 8:25234990-25235012 CCATGCCCTGAATGGGAAGCTGG + Intronic
1038197904 8:25384985-25385007 CTGCAACCTGAAAGGTAAGCTGG + Intronic
1039715841 8:40107867-40107889 CTGTGACCTGAAAGGAGAGATGG - Intergenic
1040292855 8:46134310-46134332 CGGTGGCCTGGAAGGGACGCAGG - Intergenic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1041980470 8:63852622-63852644 CTGTGGCCTGAAAGTCGAGCAGG + Intergenic
1043320197 8:78975157-78975179 CTGTGTCCTGACAAGGCAGAAGG + Intergenic
1043380980 8:79701896-79701918 CTGTGTCCTTACAGGGAAGAAGG + Intergenic
1045642961 8:104272247-104272269 ATGAGTACTGACAGGGAAGCGGG + Intergenic
1047087800 8:121538318-121538340 CTGGATCCTGATAGGGAAGTTGG - Intergenic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1049861137 8:144900382-144900404 TTCTGTCATCAAAGGGAAGCTGG - Intronic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1053062582 9:35043668-35043690 CTGGGTTCTGACAGAGAAGCTGG - Exonic
1056280947 9:85040790-85040812 CTGTGTCCCAAGAGGGCAGCGGG - Intergenic
1057310031 9:93936918-93936940 CTGAATCTTGAAAGGGAAGCAGG + Intergenic
1058188428 9:101883903-101883925 CTGTGTCCTCAAATGGTAGAAGG - Intergenic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1059430748 9:114248771-114248793 TTGGGTCCTGGAAGGCAAGCGGG - Intronic
1059881594 9:118696420-118696442 CTGTGTCCTCAAATGGCAGAGGG + Intergenic
1060200241 9:121648300-121648322 CTGGGTCCTGAAGGGTAAGCAGG + Intronic
1060205970 9:121683071-121683093 GTGTCTCCTGGAAGGGAAGGAGG + Intronic
1061218081 9:129233311-129233333 CTGAGTCCTGGACTGGAAGCTGG + Intergenic
1061620186 9:131806875-131806897 CTGGGTCCTGTGAGGGCAGCTGG + Intergenic
1061830048 9:133285914-133285936 CTTTGTCCTTACAGGGAAGGTGG + Intergenic
1061831874 9:133301412-133301434 CTTTGTCCTTACAGGGAAGGTGG - Intergenic
1062694241 9:137865015-137865037 CTGTGGCCTGTGAGGGAAGCGGG + Intronic
1062732153 9:138116086-138116108 CTCTTGTCTGAAAGGGAAGCAGG - Intronic
1185913034 X:4003352-4003374 CTGTGTTCTTAAATGGAAGAAGG - Intergenic
1187013323 X:15302101-15302123 CTGTGTCATGAGATGGCAGCTGG - Intronic
1187768602 X:22670455-22670477 CTGTGTCCTCAAAGGTAACATGG - Intergenic
1189817106 X:44834932-44834954 CTCTTTCCTGACATGGAAGCTGG - Intergenic
1193792251 X:85829431-85829453 CTGGGCCCTGACAGGAAAGCTGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1197775770 X:130117867-130117889 ATGTGTCCTCAGAGTGAAGCTGG + Intergenic
1198078819 X:133219457-133219479 CTGTGTCCTCACATGGCAGCAGG + Intergenic
1198186647 X:134259778-134259800 TAGTGCCCTGAAAGGGAAGTGGG + Intergenic
1199444201 X:147901933-147901955 CTGTTTCCTGAAGGAGGAGCAGG + Intergenic
1199549279 X:149040858-149040880 CTATGCCCTGAAATGGAAGTTGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1202109110 Y:21403562-21403584 CTGTGGCCTGAATGTGATGCCGG + Intergenic
1202120164 Y:21512557-21512579 CTGTGGCCTGAATGTGATGCCGG - Intronic
1202122615 Y:21536098-21536120 CTGTGGCCTGAATGTGATGCCGG - Intronic
1202156390 Y:21893285-21893307 CTGTGGCCTGAATGTGATGCCGG + Intronic
1202158838 Y:21916826-21916848 CTGTGGCCTGAATGTGATGCCGG + Intronic
1202185289 Y:22181741-22181763 CTGTGGCCTGAATGTGATGCCGG + Intronic
1202197574 Y:22310044-22310066 CTGTGGCCTGAATGTGATGCCGG - Intronic
1202206071 Y:22404654-22404676 CTGTGGCCTGAATGTGATGCCGG - Intronic