ID: 1158566904

View in Genome Browser
Species Human (GRCh38)
Location 18:58561726-58561748
Sequence ACTCCCACCCCCATTGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158566898_1158566904 14 Left 1158566898 18:58561689-58561711 CCACAGGAAGCTACGGAGTCTGG 0: 1
1: 0
2: 2
3: 8
4: 119
Right 1158566904 18:58561726-58561748 ACTCCCACCCCCATTGGTGGAGG 0: 1
1: 0
2: 2
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158566904 Original CRISPR ACTCCCACCCCCATTGGTGG AGG Intronic
900742746 1:4340560-4340582 CCTCCCATCCACATTGGTGGAGG + Intergenic
903217683 1:21852233-21852255 ACTCCCATCCCCACTGCTGCAGG - Exonic
903414732 1:23174374-23174396 ATGCCCACCCACATTGGTGGAGG + Intronic
903431912 1:23310797-23310819 GCTCCCCTCCCCCTTGGTGGTGG + Exonic
904049958 1:27633073-27633095 ACTCACACCCTCACTGGAGGAGG + Intronic
904926381 1:34051925-34051947 ACCCCCACCCCCATTAGTGAGGG - Intronic
904936405 1:34132621-34132643 AGGCCCACCCACATTGGTGAGGG - Intronic
907426208 1:54380738-54380760 ACCCCCAACCCCATGGTTGGGGG - Intronic
910158093 1:84243246-84243268 ACCCCCACCCCCAGTCTTGGGGG - Intergenic
916459168 1:165004806-165004828 ATGCCCACCCCCATTGGGGAGGG + Intergenic
916845418 1:168645186-168645208 ATGCCCACCCACATTGGTGATGG + Intergenic
918699395 1:187589182-187589204 ACACCCACCTACATTGGTGATGG - Intergenic
919878736 1:201888858-201888880 AGTCCCACCCCCAGAGGAGGCGG + Exonic
919922444 1:202174543-202174565 CATCCCTCCCCCACTGGTGGGGG - Intergenic
923385630 1:233462800-233462822 GCTCCCCTCCCAATTGGTGGAGG + Intergenic
923679835 1:236110608-236110630 TCCCACACCCCCAGTGGTGGCGG + Intergenic
1062843528 10:688878-688900 GATCCCACCCCCATTGTTCGCGG - Intronic
1063449698 10:6143215-6143237 ACTCACACCCCCAAAGGCGGTGG + Intergenic
1064111081 10:12539601-12539623 ACTCCCATCCCTGATGGTGGGGG - Intronic
1064480503 10:15735944-15735966 ACTCCCAACCCCATTCCTGCTGG + Intergenic
1065034598 10:21624936-21624958 GCTCCCCTCCCCCTTGGTGGTGG + Intronic
1068139751 10:52990939-52990961 AATGCCACCCCCAGTGTTGGAGG - Intergenic
1069800189 10:71077182-71077204 ACTTCCACCCTCATAGGTGAGGG + Intergenic
1074377582 10:112951932-112951954 TCCCCCTCCCCCTTTGGTGGTGG + Intronic
1074442552 10:113491495-113491517 ACTCCCACTCCCATTGGCTGAGG - Intergenic
1074531841 10:114303731-114303753 ACTCCCACCCCAGTAGCTGGAGG + Intronic
1078211407 11:9272780-9272802 ATGCCCACCCACATTGGTGAGGG + Intergenic
1083871109 11:65489092-65489114 ACCCCCACCCCCACTGTTTGTGG - Intergenic
1085940875 11:81205404-81205426 ACACCCACTCACATTGGTGAGGG - Intergenic
1086196175 11:84142606-84142628 ACTCTCACCCGCATTGGTGAGGG - Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1089011259 11:115133647-115133669 ACACCCACTCACATTGGTGAAGG - Intergenic
1089164437 11:116464277-116464299 AGGCCCACCCACATTGGTGAGGG - Intergenic
1093415669 12:18917748-18917770 ACACCCACCCACACTGGTGAAGG - Intergenic
1094057733 12:26283828-26283850 ACTGCCACCCACATTGAGGGTGG - Intronic
1094534023 12:31305211-31305233 ACTCCCTCCAGCCTTGGTGGAGG - Intronic
1094712448 12:32978563-32978585 GATCCCACCCCCAGTGCTGGAGG + Intergenic
1096780595 12:53989673-53989695 ACTCCCACCCCCATCTATGAGGG - Exonic
1098159379 12:67634684-67634706 TCTCCCACCCCCAATGGCTGGGG - Intergenic
1098955711 12:76687604-76687626 ACCCCCACCCCCATATGTTGGGG + Intergenic
1100836574 12:98572200-98572222 GCTACCACCCCTAGTGGTGGAGG - Intergenic
1100980450 12:100158542-100158564 ACTCCCATGCCTATTGGTAGTGG - Intergenic
1102298352 12:111754166-111754188 ACTCCCAGGGCCATTGGTGGAGG + Intronic
1104140827 12:125984285-125984307 CCCCCCACGCCCCTTGGTGGAGG + Intergenic
1106475747 13:30096666-30096688 CCTCCCTGCCCCATTGATGGAGG + Intergenic
1106877953 13:34095986-34096008 ATTCCCACCTACATTGGTGAGGG + Intergenic
1108464411 13:50700489-50700511 AATTCCACCACCATGGGTGGTGG + Intronic
1108625924 13:52228771-52228793 ACTCCCAGCCACAGTGCTGGGGG - Intergenic
1108660142 13:52577709-52577731 ACTCCCAGCCACAGTGCTGGGGG + Intergenic
1109378266 13:61525227-61525249 AGCCCCAACCCCATTGATGGAGG - Intergenic
1110666529 13:78123902-78123924 ATTCCCACCCACATTGGGGGTGG - Intergenic
1113216724 13:108049439-108049461 AGTCCCACCCACATTCGTGACGG - Intergenic
1114802239 14:25790217-25790239 ACTCACACATCCATTGGCGGAGG - Intergenic
1115742494 14:36403294-36403316 ATGCCCACCCCCATTGGTGAGGG - Intergenic
1115754742 14:36519780-36519802 ACCCCCACCCCCATTTTTTGTGG + Intronic
1116586177 14:46707505-46707527 ATGCCCACCCACATTGGTGAGGG + Intergenic
1116981390 14:51174681-51174703 ATGCCCACCTACATTGGTGGGGG - Intergenic
1118469429 14:66061401-66061423 AAGCTCACCCCCATTGGTGAGGG + Intergenic
1120897160 14:89543893-89543915 CCCCCCACCCCCATTGGTTTTGG - Intronic
1121452241 14:94016438-94016460 ACTCCCACCCCCTTCACTGGGGG + Intergenic
1124432197 15:29617385-29617407 ATGCCCACCCACATTGGTGAGGG + Intergenic
1125347169 15:38730016-38730038 ACTTCTACCCACATTGGTGAGGG + Intergenic
1125509590 15:40285792-40285814 ACTCACACCCCCCCAGGTGGAGG + Intronic
1127139678 15:55961990-55962012 ACTCCCACCGTCATAGTTGGAGG - Intronic
1127286804 15:57539913-57539935 ACTGCCTACCTCATTGGTGGTGG + Intronic
1128740949 15:70083391-70083413 CCTCCCACCCCTACTTGTGGGGG + Intronic
1131683227 15:94745527-94745549 CCTCCCACACCCATAGGTGCTGG + Intergenic
1131860637 15:96649796-96649818 ACTCCCTCACCCATTTGTGGGGG + Intergenic
1131997206 15:98144209-98144231 AGGCCCACCCACATTGGTGAGGG + Intergenic
1132057075 15:98660418-98660440 ATTCCCCTCCCCAATGGTGGGGG - Intronic
1132145013 15:99424502-99424524 ACTCCCATCCCCATGGATGAAGG + Intergenic
1132421910 15:101677253-101677275 AGGCCCACCCACATTGGTGAGGG - Intronic
1134257753 16:12625844-12625866 CCCCCCACCCCAATTGCTGGGGG + Intergenic
1137526528 16:49241235-49241257 ACTTTCACTCCCATTGGTTGAGG - Intergenic
1137781832 16:51103846-51103868 ATTCCCACGTCCATTGGTGGAGG - Intergenic
1138633886 16:58321071-58321093 CCTCCCAGCCCCCTTGGTGATGG + Intronic
1141621820 16:85240389-85240411 ACCCCCCTCCCCCTTGGTGGGGG - Intergenic
1144971084 17:19110391-19110413 ACTCCCACCCTGATTGGAGCAGG + Intergenic
1144991386 17:19236554-19236576 ACTCCCACCCTGATTGGAGCAGG + Intronic
1147164580 17:38586531-38586553 ACTCCCTTCCCCAGGGGTGGGGG + Intronic
1148460696 17:47837651-47837673 TCTCCCACCCCCACTGGTCCTGG + Exonic
1149506097 17:57195160-57195182 AGTCCCACCCACATGGGAGGTGG - Intergenic
1151965381 17:77428482-77428504 ACTCCCACCCAGTTTGGGGGTGG - Intronic
1153077523 18:1182048-1182070 ATGCCCACCCACATTGGTGAGGG - Intergenic
1156212220 18:34957278-34957300 ACTCCCTTCCACATTGGTGGAGG - Intergenic
1157191840 18:45588413-45588435 TCTCCCACCCACATGGCTGGAGG + Intronic
1157679007 18:49589028-49589050 ACTCCCTCTGCCATTGCTGGGGG - Intronic
1157894519 18:51452302-51452324 ATGCCCACCCACATTGGTGAAGG + Intergenic
1158566904 18:58561726-58561748 ACTCCCACCCCCATTGGTGGAGG + Intronic
1158893635 18:61894454-61894476 CCCCCCACCCCCTTTGGTGCCGG - Intergenic
1159666982 18:71173581-71173603 ACACCCACCTACATTGGTGAGGG - Intergenic
1161030588 19:2056212-2056234 ACCCCCACCTGCCTTGGTGGGGG + Intergenic
1161044307 19:2126928-2126950 TCTTCCACCGCCATTGGTGCTGG - Intronic
1163340347 19:16702282-16702304 ACTCCCAGCTCAATTAGTGGAGG + Intergenic
1164453141 19:28383921-28383943 ACTCCCACCTCTGTTGGTTGAGG - Intergenic
1164940927 19:32251876-32251898 ACTTCCACCTCCAATGTTGGGGG - Intergenic
1165293255 19:34905869-34905891 ACTCCCACTGCGATGGGTGGGGG - Intergenic
1166351700 19:42201877-42201899 TCTCCCACCCACATTGATTGAGG - Intronic
1166368054 19:42287115-42287137 ACCCCCACACCCTTTGGGGGTGG + Exonic
1168358728 19:55719845-55719867 CCTCCCACCCCCATTGTGTGTGG - Intronic
929281622 2:40086841-40086863 AAGCACAGCCCCATTGGTGGTGG - Intergenic
929549763 2:42882188-42882210 ATCCCCACCCACATTGGTGAGGG - Intergenic
930091686 2:47535465-47535487 AGCCCCACCCCCATTAGAGGAGG - Intronic
930255014 2:49080738-49080760 ACTGCCCCTCCCAGTGGTGGTGG + Intronic
930430418 2:51268363-51268385 ATGCCCACCCACATTGGTGAAGG + Intergenic
930897499 2:56462954-56462976 ACGCCCACCCACTTTGGTGACGG + Intergenic
931439083 2:62274652-62274674 ATGCCCACCCACATTGGTGAGGG + Intergenic
932715783 2:74100172-74100194 CCTCCCACCCCCAGTGGGGCTGG + Intronic
934965739 2:98720297-98720319 ATACCCACCCACATTGGTGAGGG - Intronic
937373247 2:121317239-121317261 ACTCACTCCCCCATAGGAGGAGG + Intergenic
937598717 2:123703360-123703382 ACTCCCAACCCCATAAGTGTAGG + Intergenic
937937054 2:127254498-127254520 AGGCCCACCCACGTTGGTGGGGG + Intergenic
938963373 2:136362813-136362835 ACTTTCACCCCCATTTGTAGAGG - Intergenic
939935833 2:148292601-148292623 ACTCCCACCAACATTGTAGGAGG - Intronic
942459883 2:176161340-176161362 ACTACCACCCCCAATGCTGCCGG - Intronic
943415248 2:187593494-187593516 AGGCCCACCCACATTGGTGCAGG + Intergenic
945011048 2:205464110-205464132 ACTGCCAGCCCTCTTGGTGGTGG + Intronic
946133066 2:217622505-217622527 ACTCCCACCACTGGTGGTGGGGG + Intronic
947123714 2:226844306-226844328 TCTCCCACTCCCATTGGATGCGG - Intronic
1174006728 20:47416788-47416810 CCTCCCACCAGCACTGGTGGGGG + Intergenic
1174042367 20:47709063-47709085 TCTCCCACCTCCACTGGTGCCGG - Intronic
1175951832 20:62587755-62587777 ACTCCTGCCCCTCTTGGTGGGGG + Intergenic
1179599823 21:42469568-42469590 ACTCCCACACGCAATGGTGCTGG - Intergenic
1180964024 22:19776343-19776365 CCTCCCACCCCCAGTGAGGGAGG - Intronic
1181631330 22:24153116-24153138 ACCCCCCACCCCAGTGGTGGTGG - Intronic
1182466559 22:30520450-30520472 CCTCCCCCTCCCTTTGGTGGGGG + Intergenic
1183384867 22:37509045-37509067 ACTCCCACCCCCATGACTAGGGG + Intronic
1183976494 22:41515428-41515450 TCCCACACCCCCAATGGTGGCGG + Exonic
950141166 3:10616690-10616712 ACACACACACTCATTGGTGGGGG + Intronic
950312048 3:11967295-11967317 ACACCCACCCATATTGGTGAGGG - Intergenic
951551995 3:23883425-23883447 AGTCCCATCCCCAGGGGTGGAGG - Intronic
953183936 3:40621000-40621022 ACTCCCATCCCCATTGCTGGTGG - Intergenic
953488726 3:43328567-43328589 CTTCCCACCCCCATTTGTGGAGG + Intronic
953911787 3:46896877-46896899 ACTCCCACGGCCACTGCTGGGGG - Intronic
954438751 3:50510067-50510089 TCCCCCAACCCCCTTGGTGGGGG - Intergenic
955089234 3:55732938-55732960 ACCCCCACCCCCAATGACGGGGG + Intronic
956898050 3:73683942-73683964 AGACCCACCCTCAGTGGTGGTGG - Intergenic
956963645 3:74433202-74433224 GCTCCCAACCCCAATAGTGGAGG + Intronic
958719429 3:97825686-97825708 CCTCCCACCCACCTGGGTGGAGG - Intronic
960908924 3:122629446-122629468 AATCCCACCCCCACAGGTGAGGG + Intronic
962156464 3:132953655-132953677 ATGCCCACCCACATTGGGGGAGG - Intergenic
962717473 3:138139064-138139086 ATGCCCACCCACATTGGTGAGGG - Intergenic
964408536 3:156375325-156375347 ACTCCCAGCCACTTTTGTGGTGG + Intronic
967120712 3:186380397-186380419 GCACCCACCCACATTGGTGAGGG + Intergenic
967124051 3:186408899-186408921 ACTCCCAGCACCATCGATGGGGG - Intergenic
968200448 3:196749715-196749737 ACCCCCACATCCATTGCTGGTGG - Intronic
970191216 4:13521403-13521425 AGTCCCACCTCCATGGATGGAGG - Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
972667393 4:41180349-41180371 AATCCCAGCCCCATGGGAGGGGG + Intronic
975776965 4:77797813-77797835 AGTCCCACCCTTATTTGTGGAGG - Intronic
976541793 4:86285981-86286003 ACTCCCACCCACATTAGTGAGGG + Intronic
977089184 4:92649458-92649480 ATGCCCACCCACATTGGTGAGGG + Intronic
977337803 4:95720189-95720211 ATACCCACCCCCATTGGGGAGGG + Intergenic
978390537 4:108220575-108220597 CCTCCCTCCCCCACAGGTGGGGG - Intergenic
978439370 4:108717389-108717411 ACTTACTCCCCCATTGGTTGAGG - Intergenic
982455987 4:155610185-155610207 AGTCCCACCCCCATTGGTGAGGG - Intergenic
984288843 4:177767043-177767065 AGACCCACCCCCATTGTGGGTGG - Intronic
985385807 4:189447159-189447181 ACATCCACCCACATTGGTGAGGG - Intergenic
988846479 5:35132959-35132981 AAGCCCACCCACATTGGTGAGGG - Intronic
989955333 5:50352584-50352606 ACACCCTCCCACATTGGTGAGGG - Intergenic
997143072 5:131403744-131403766 AATCCCAGCACCATTTGTGGGGG - Intergenic
1001339727 5:170832156-170832178 ATGCCCACCCACATTGGTGAGGG + Intergenic
1001920672 5:175596935-175596957 ACACCCACCCCTAGTGGGGGTGG - Intergenic
1002453464 5:179332359-179332381 ACTCCCATCCCCAGAGGTTGGGG + Intronic
1003769855 6:9288261-9288283 ACACCCACCCACATTGGTGAGGG - Intergenic
1006763178 6:36481729-36481751 TATTCCTCCCCCATTGGTGGAGG - Exonic
1006798059 6:36743533-36743555 ACTCCTACTCCCTTCGGTGGTGG + Intronic
1007420545 6:41716670-41716692 ACCCCCACCCCCTTTAGTGCTGG + Intronic
1008702313 6:54115826-54115848 ACTTCCAGGCCCATTGGTGCAGG + Intronic
1010233787 6:73558218-73558240 ACTGCCACAGCCATTTGTGGTGG - Intergenic
1010918481 6:81650380-81650402 ATGCCCACCCACATTGGTGAAGG - Intronic
1011806037 6:91073502-91073524 ATGCCCACCCCCATTGGGGAGGG + Intergenic
1012775591 6:103490516-103490538 ACTCCCAACCTCATAGGTGAGGG + Intergenic
1015596112 6:134868858-134868880 AACCCCACCCCCACAGGTGGTGG - Intergenic
1017272515 6:152524894-152524916 ACTCCCATATCCATTGGTTGAGG + Intronic
1019134010 6:169897067-169897089 GCCCCCACCCCCTTTGATGGTGG - Intergenic
1019604314 7:1900947-1900969 GCTCCCAGCCGCATGGGTGGTGG - Intronic
1019870648 7:3757712-3757734 TCTTCCAACCCCATTGCTGGAGG + Intronic
1020260574 7:6528667-6528689 ACTCCTACCCACAGAGGTGGAGG - Intronic
1022665004 7:32402543-32402565 ATGCCCACCCACATTGGTGAGGG + Intergenic
1024358515 7:48443770-48443792 CCTCCCACTCCCATTGGAGGAGG + Intronic
1025798929 7:64765945-64765967 ACTCTCACCCTCATTTGTGAGGG + Intergenic
1026681162 7:72467538-72467560 AGCCCCACCCAGATTGGTGGGGG + Intergenic
1026963449 7:74424447-74424469 ACTCCACCCCCCAGTGGTTGAGG + Intergenic
1028170672 7:87591693-87591715 ACCCCCACCCCCATTCCTTGAGG - Intronic
1029162249 7:98560691-98560713 AGTCCATCCCCCTTTGGTGGTGG - Intergenic
1031818205 7:126466766-126466788 ATGCCCACCCACACTGGTGGAGG + Intronic
1032002453 7:128274267-128274289 ATTCCCATCCCCAGTGCTGGAGG - Intergenic
1032483246 7:132263242-132263264 AGTCCCCACCCCACTGGTGGTGG - Intronic
1036552953 8:9831379-9831401 AGGCCCACCTCCAATGGTGGGGG - Intergenic
1037470670 8:19206731-19206753 ACTTACACCCCCATCAGTGGTGG + Intergenic
1038065355 8:23958045-23958067 ACGCCCATCCACATTGGTGAGGG + Intergenic
1039787204 8:40844323-40844345 ATGCCCATCCTCATTGGTGGAGG - Intronic
1040834979 8:51722279-51722301 ACTCCAACCCCTATGGGAGGGGG + Intronic
1044026267 8:87175935-87175957 AATACCCCCTCCATTGGTGGGGG + Intronic
1048379073 8:133847965-133847987 AATCCTTCCCCCATTGATGGTGG + Intergenic
1050355226 9:4776537-4776559 AGGCCCACCCACATTGGTGAGGG - Intergenic
1051235070 9:14990979-14991001 ATGCCCACCCACATTGGTGAGGG - Intergenic
1051480139 9:17550632-17550654 ATGCCCACTCCCACTGGTGGGGG - Intergenic
1053008706 9:34621414-34621436 AGTCCCAGCCCCATTGCTGAGGG - Exonic
1053064399 9:35057307-35057329 ACTCCCATCCCTTTTGGTGTAGG + Intronic
1053313599 9:37034878-37034900 ACCCCCACCCCAATTTGTTGGGG + Intergenic
1054712902 9:68529400-68529422 ATTCCAACTACCATTGGTGGAGG + Intronic
1056310147 9:85332682-85332704 ACTCCCATCCCCATTGCTTCAGG + Intergenic
1057498619 9:95579449-95579471 ACACCCACCCTCATTGGTGAGGG - Intergenic
1058667552 9:107334383-107334405 ACACCCACCTGCATTGGTGAGGG + Intergenic
1060307766 9:122431796-122431818 ATGCCCACCCACATTGGTGAAGG - Intergenic
1062125411 9:134858096-134858118 ACTGCCACCCCACTTGGTGCAGG + Intergenic
1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG + Intronic
1062582006 9:137232938-137232960 ACTCCCTCCCCGGGTGGTGGGGG + Intronic
1203788186 EBV:139588-139610 ACTGCCAGCCCCATTGGGGAGGG + Intergenic
1187680179 X:21759907-21759929 ACTTCCATTCCCATTGGTTGAGG - Intergenic
1189168030 X:38880731-38880753 ACTCCCAGCCCCACTAGTGCTGG - Intergenic
1189473292 X:41330876-41330898 ACTTCCACCCCCATTCCTGGAGG - Intergenic
1191671545 X:63752877-63752899 ACAGCCACCCACATGGGTGGAGG + Intronic
1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG + Intergenic
1199556807 X:149118197-149118219 ATGCCCACCCACATTGGTGAGGG + Intergenic
1199825514 X:151494979-151495001 ATGCCCACCCACATTGGTGACGG + Intergenic
1201609298 Y:15823139-15823161 ACTCCCACTCCCATGAGGGGTGG - Intergenic