ID: 1158568543

View in Genome Browser
Species Human (GRCh38)
Location 18:58576327-58576349
Sequence TCGTACCATTGCTCCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158568543 Original CRISPR TCGTACCATTGCTCCAGCCC AGG Intronic
901285956 1:8079187-8079209 TCGTGCCACTGCACCAGCCTGGG + Intergenic
901588078 1:10315220-10315242 TTGCACCATTGCTCTAGCCTGGG - Intronic
901950492 1:12741683-12741705 TCGCACCACAGCTCCAGCCTAGG - Intergenic
902215459 1:14931774-14931796 TCGTCCCTGTGCTCCAGCCTGGG - Intronic
903073937 1:20746969-20746991 TTATACCACTGCTCCAGCCTGGG + Intronic
903492661 1:23741468-23741490 TCGCACCACTGCTCCAGCCTGGG - Intergenic
904544845 1:31261304-31261326 TTGCACCATTGCTCCAACCTGGG + Intronic
904545478 1:31267573-31267595 CCGTTGCACTGCTCCAGCCCGGG - Intronic
904741710 1:32682373-32682395 TCGTGCCACTACTCCAGCCTGGG + Exonic
905224293 1:36469037-36469059 TCCTACCATACTTCCAGCCCTGG - Intronic
905374282 1:37508321-37508343 TCGTGTCACTGCTCCAGCCTGGG - Intronic
906133936 1:43482019-43482041 TCACGCCATTGCTCCAGCCTGGG - Intergenic
906321044 1:44815797-44815819 TGGGACCATTGCTTGAGCCCAGG - Intergenic
906358171 1:45126929-45126951 TGGTAGCATTGCTTGAGCCCAGG - Intronic
906997356 1:50810998-50811020 TCGTGCCACTGTTCCAGCCTGGG + Intronic
908528578 1:65011698-65011720 TCCTACCCTTGCTCCATCCTGGG - Intergenic
908578520 1:65488422-65488444 TGGGAGGATTGCTCCAGCCCAGG - Intronic
911112576 1:94206849-94206871 TCACACCACTGCACCAGCCCAGG + Intronic
911443572 1:97962370-97962392 TCATCCCACTGCTCCAGCCTGGG - Intergenic
914682734 1:149950834-149950856 TCGCGCCACTGCTCCAGCCTGGG - Intronic
915484977 1:156213954-156213976 TCGCGCCACTGCTCCAGCCTGGG - Intronic
915979370 1:160410479-160410501 TCCTGCCACTGCTCTAGCCCGGG - Intronic
916535638 1:165700638-165700660 TGGCACCACTGCTCCAGCCTGGG + Intergenic
917855667 1:179097340-179097362 TGAAACCATGGCTCCAGCCCTGG - Intronic
918591099 1:186242133-186242155 TCTTACCATTTTGCCAGCCCAGG - Intergenic
919986064 1:202676113-202676135 TCTCACTGTTGCTCCAGCCCAGG + Intronic
920926875 1:210349693-210349715 TGGTACCATTGCTCTAGCCTGGG - Intronic
922264876 1:223974304-223974326 TGGTAATATTGCTCAAGCCCTGG - Intergenic
922573405 1:226646731-226646753 TCTTTCCATTTCCCCAGCCCTGG - Intronic
923720100 1:236459655-236459677 TGGCACCATTGCTCCAGGCTGGG - Intronic
924548352 1:245051344-245051366 TCGTGCCACTTCTCCAGCCTGGG + Intronic
1063412940 10:5850664-5850686 TGGGAAGATTGCTCCAGCCCAGG - Intergenic
1063533030 10:6854090-6854112 TCGCACCACTGCTCCAGCTTGGG + Intergenic
1065094295 10:22265486-22265508 TTGAGCCATTGCTCCAGACCTGG - Intergenic
1066465608 10:35647401-35647423 TCATAGCAGTCCTCCAGCCCTGG - Intergenic
1069864864 10:71495773-71495795 TTGTGCCACTGCACCAGCCCAGG + Intronic
1069999472 10:72365611-72365633 TCTTCTCATTGCTCCAGGCCTGG - Intergenic
1070171352 10:73935283-73935305 TGGGATGATTGCTCCAGCCCAGG - Intergenic
1071863210 10:89697403-89697425 TGGTACGATTGCTTGAGCCCAGG - Intergenic
1072194125 10:93101067-93101089 TCATGCCACTGCTCCAGCCTGGG - Intergenic
1072940689 10:99760961-99760983 TCCTGCCACTGCTCCAGCCTGGG - Intergenic
1073318484 10:102599562-102599584 TCGTCCTCTTGTTCCAGCCCAGG - Intronic
1073378785 10:103061346-103061368 TCGCGCCACTGCTCCAGCCTGGG + Intronic
1073778715 10:106813858-106813880 TGGGAGGATTGCTCCAGCCCGGG + Intronic
1075161309 10:120027096-120027118 GCCTACCCTTGCTCCAGCCCAGG - Intergenic
1075339822 10:121637804-121637826 TTGCACCACTGCACCAGCCCGGG - Intergenic
1075592341 10:123702084-123702106 TCACGCCATTGCTCCAGCCTTGG - Intergenic
1075935465 10:126337302-126337324 TCTTCCCATTCCTCCTGCCCTGG - Intronic
1076093943 10:127714920-127714942 GGGTACCATTGCTCCAGCGTTGG - Intergenic
1076820876 10:132938974-132938996 ACGTGCCATGGCTCCAGCGCAGG + Intronic
1076984422 11:224682-224704 TCATGCCATTGCCTCAGCCCTGG + Intronic
1080573865 11:33580527-33580549 TCGTGCCATTACTCCAGGCTGGG + Intronic
1082929186 11:58581400-58581422 TCGTGGCACTGCTCCAGCCTGGG - Intronic
1083820233 11:65166450-65166472 TCGCGCCACTGCTCCAGCCTGGG - Intergenic
1084501034 11:69535556-69535578 TCATGCCACTGCTCCAGCCTGGG - Intergenic
1085065509 11:73491930-73491952 TCTTTCCATTCCTCCAGCACAGG + Intronic
1086385740 11:86305429-86305451 TCGCGCCATTGCACCAGCCTGGG - Intronic
1091860204 12:3774440-3774462 TCGTGCCACTGCACCAGCCTGGG + Intergenic
1092475233 12:8813425-8813447 TCGTGCCACTACTCCAGCCTGGG - Intergenic
1093454679 12:19353502-19353524 TCGCACCATTGCACCAGCGTGGG - Intronic
1096285319 12:50294977-50294999 TCGTGCCATTGCACCAGCCTGGG - Intergenic
1097519694 12:60651920-60651942 TCTTGCCATTGCTCCATCCGGGG - Intergenic
1098228206 12:68346506-68346528 TCGTGCCATTGCACCAGCCTGGG - Intergenic
1100269473 12:93011080-93011102 TCGTACCATCACTCCAGACTGGG - Intergenic
1101922878 12:108947169-108947191 TAGTTCCCTTGCCCCAGCCCTGG + Intronic
1102106225 12:110325941-110325963 TGGTGCCATTGCACCAGCCCGGG + Intronic
1103048602 12:117760062-117760084 TCCCACCACTGCTCCAGCCTGGG + Intronic
1103077213 12:117993711-117993733 TTGCACCACTGCTCCAGCCAGGG - Intergenic
1103083212 12:118041692-118041714 TCTTTCAATTCCTCCAGCCCTGG - Intronic
1103765312 12:123275320-123275342 TGGCACCATTGCTCCAGCCTGGG + Intergenic
1103776035 12:123366987-123367009 TCGTGCCACTGCACCAGCCTGGG + Intergenic
1105686340 13:22785965-22785987 TCGCACCACTGCACCAGCCTGGG + Intergenic
1105910274 13:24857851-24857873 TCATGCCACTGCTCCAGCCTGGG + Intronic
1106174150 13:27314656-27314678 TGGGAGCATTGCTTCAGCCCAGG - Intergenic
1106836046 13:33636095-33636117 TCATACCATTGCACTAGCCTGGG + Intergenic
1107468593 13:40670009-40670031 TCACACCACTGCTCCAGCCTAGG + Intergenic
1113185916 13:107685268-107685290 CTGTGCCATTGCTCCAGCCTGGG + Intronic
1113575034 13:111389267-111389289 TTGGACCATAACTCCAGCCCAGG - Intergenic
1114069437 14:19096000-19096022 TCGCTCCATAGCTCCAGGCCAGG + Intergenic
1114092825 14:19304003-19304025 TCGCTCCATAGCTCCAGGCCAGG - Intergenic
1115621213 14:35142438-35142460 TGGGAGGATTGCTCCAGCCCAGG - Intronic
1115657193 14:35455098-35455120 TCGCACCACTCCTCCAGCCTGGG - Intergenic
1118342468 14:64906428-64906450 TTGTGCCATTGCTCCAGCCTGGG - Intergenic
1123688232 15:22815571-22815593 TTGAACCACTGCTCCAGCCTGGG + Intronic
1125783744 15:42296097-42296119 TCATACCATTGCTCCAGGCGGGG + Intronic
1128040019 15:64563729-64563751 TCGCGCCATTGTTCCAGCCTGGG + Intronic
1128406781 15:67349561-67349583 TTGCGCCATTGCTCCAGCCTGGG + Intronic
1129716217 15:77852654-77852676 TCATAGCATTTTTCCAGCCCTGG - Intergenic
1130005172 15:80089303-80089325 TCGTGCCACTGCTCCAGCCTGGG - Intronic
1131616534 15:94022243-94022265 TCCTGACACTGCTCCAGCCCAGG - Intergenic
1133516256 16:6512189-6512211 TCGTAGGATTGCTTGAGCCCAGG + Intronic
1134673065 16:16070152-16070174 TGGTAGGATTGCTTCAGCCCAGG + Intronic
1134843618 16:17421928-17421950 TGGGAACATTGCTTCAGCCCAGG - Intronic
1134898580 16:17912968-17912990 TGGGAGGATTGCTCCAGCCCAGG + Intergenic
1136575898 16:31124982-31125004 TTGCACCATTGCTCCAGCCTGGG + Intronic
1136591191 16:31218805-31218827 TCATGCCACTGCTCCAGCCAGGG + Intronic
1137749495 16:50848956-50848978 ACATAACATTGCTCAAGCCCAGG + Intergenic
1138049360 16:53760290-53760312 TCGCACCACTGCACCAGCCTGGG - Intronic
1139584775 16:67894966-67894988 TCGCGCCATTGCTCCAGCCTGGG - Intronic
1139671706 16:68496825-68496847 ATGTAGCATGGCTCCAGCCCTGG - Intergenic
1140027256 16:71301823-71301845 TCCTTTCACTGCTCCAGCCCAGG - Intergenic
1140850168 16:78927751-78927773 TCGTTTCATTGCTCCAGCGTGGG + Intronic
1141912836 16:87071744-87071766 TCGTACCACTGCACCAGCCTGGG - Intergenic
1143060819 17:4199232-4199254 TCGTGCCAGTGCACCAGCCTGGG - Intronic
1143345115 17:6243525-6243547 TCCTAACATTGCTGCAGCCCTGG - Intergenic
1143511932 17:7401154-7401176 TGGGAACATTGCTCGAGCCCAGG - Intronic
1143817850 17:9533420-9533442 TCGTGCCACTGCTCCAGCCTGGG + Intronic
1143823925 17:9588813-9588835 TTGTGCCATTACTCCAGCCTGGG - Intronic
1144061039 17:11583488-11583510 TGGCAACATTGCTCCATCCCTGG - Intergenic
1144262354 17:13534633-13534655 TGGTAGGATTGCTGCAGCCCAGG + Intronic
1147417755 17:40305942-40305964 TCGCGCCACTGCTCCAGCCTGGG - Intergenic
1148917824 17:50998075-50998097 TCATGCCATTGCTCTAGCCTGGG - Intronic
1149685411 17:58531955-58531977 CCTTACCATGGCTGCAGCCCGGG + Intronic
1149694674 17:58607546-58607568 TCACACCATTGCTTCACCCCTGG + Intronic
1149747754 17:59115684-59115706 TGGGACGATTGCTCGAGCCCAGG - Intronic
1149894685 17:60420620-60420642 TCACGCCATTGCTCCAGCCTGGG + Intronic
1150095927 17:62375019-62375041 TCGGAGAATTGCTCGAGCCCAGG + Intronic
1150355301 17:64478850-64478872 TCACGCCATTGCACCAGCCCGGG + Intronic
1152342147 17:79731192-79731214 TTGTACCGGTGCTCCGGCCCCGG - Exonic
1154126821 18:11699237-11699259 TGGTACTACTGCTCCAGCCTAGG - Intronic
1157251443 18:46099543-46099565 TCAGAGGATTGCTCCAGCCCAGG - Intronic
1158240341 18:55370359-55370381 TTGCACCACTGCTCCAGCCTGGG + Intronic
1158568543 18:58576327-58576349 TCGTACCATTGCTCCAGCCCAGG + Intronic
1162295884 19:9813026-9813048 TCGTGCCGTTGCACCAGCCTGGG + Intronic
1162618167 19:11818592-11818614 TCGCACCACTGCTCCAGCCTGGG - Intronic
1162622086 19:11851700-11851722 TGGCACCACTGCTCCAGCCTGGG - Intronic
1162626918 19:11892020-11892042 TCGCACCACTGCTCCAGCCTGGG - Intronic
1162636059 19:11968294-11968316 TCGCACCACTGCTCCAGCCTGGG - Intronic
1164653529 19:29902895-29902917 TCGTACCTTGTCTCCAGCCTTGG + Intergenic
1165402305 19:35609594-35609616 TCGGGCCATGGCTCCAGCCTGGG + Intergenic
1165586475 19:36920576-36920598 TGGTGCCATTACTCCAGCCTGGG + Intronic
1166574358 19:43823532-43823554 TCGTGCCATTGCTCCAGCCTGGG + Intronic
1166608898 19:44170866-44170888 TCGTGCCACTACTCCAGCCTGGG + Intronic
1167154886 19:47732162-47732184 CCGTGCCATTGCACCAGCCTGGG - Intronic
1167600169 19:50450346-50450368 TGGGAGAATTGCTCCAGCCCAGG - Intronic
1168547534 19:57266063-57266085 TCGCACCACTGCTCCAGCCTGGG - Intergenic
928149039 2:28810172-28810194 TCGTGCCACTGCTCCAGCCTGGG + Intronic
928227736 2:29468071-29468093 TCGTGCCACTACTCCAGCCTGGG - Intronic
929540077 2:42812134-42812156 TGGCACCACTGCTCCAGCCTGGG + Intergenic
930049422 2:47203164-47203186 ATGCACCATTCCTCCAGCCCCGG - Intergenic
930896176 2:56449236-56449258 TCGCTCCATTCCTCCAGCTCTGG - Intergenic
931396209 2:61890262-61890284 TGGTGCCACTGCTCCAGCCTGGG - Intronic
932041529 2:68304663-68304685 TCGCACCACTGCTCCGGCCTGGG - Intronic
932131858 2:69194806-69194828 TCGCACCACTGCTCCAGCCTGGG + Intronic
936403401 2:112182868-112182890 TCTTACCGTTGCACCTGCCCCGG + Exonic
942302751 2:174577872-174577894 TCATACCATTACTCCAGCCTGGG + Intronic
944489357 2:200242117-200242139 TTGTACCATGACTCCAGCCTGGG - Intergenic
945238889 2:207658689-207658711 TCGCACCATTGCACCAGCCTGGG + Intergenic
947613017 2:231535588-231535610 TCGCACCACTGCACCAGCCTGGG - Intergenic
948000630 2:234563895-234563917 TCGCACCACTGCTCCAGGCTGGG + Intergenic
948429274 2:237908954-237908976 TCCTACCCTGGCTGCAGCCCTGG + Intronic
1170180838 20:13528176-13528198 TCGCACCACTGCTCCAGCATGGG + Intronic
1170369598 20:15634637-15634659 TAGTACCATTGCCACAGCCATGG - Intronic
1172244535 20:33436919-33436941 TCGCGCCACTGCTCCAGCCTGGG + Intronic
1172610421 20:36247237-36247259 TAGTACCATTTCCCTAGCCCCGG + Intronic
1172707102 20:36890008-36890030 TAGTTCCAGTGCTCAAGCCCAGG - Intronic
1174433668 20:50489936-50489958 TCGCACCACTGCTCCAGCCTGGG - Intergenic
1174716631 20:52766023-52766045 TTGCACCACTGCTCCAGCCTGGG - Intergenic
1174803501 20:53585498-53585520 TCGCACCACTGGTCCAGCCTGGG + Intronic
1175092781 20:56518726-56518748 TCGTCCCTCTGCTACAGCCCTGG + Exonic
1175192604 20:57221716-57221738 TGGGACGATTGCTCCAACCCAGG + Intronic
1176414161 21:6465590-6465612 TCGCACCACTGCTCCAGCCTGGG - Intergenic
1177702380 21:24655341-24655363 TCATGCCATTGTTCCAGCCTGGG - Intergenic
1178373157 21:32044449-32044471 TCAAAACATTGCTCTAGCCCGGG + Intronic
1178991398 21:37359453-37359475 TCATGCCACTGCTCCAGCCTGGG + Intergenic
1179689659 21:43073912-43073934 TCGCACCACTGCTCCAGCCTGGG - Intronic
1179966824 21:44812099-44812121 TCATATCACTGCTCCAGCCTGGG - Intronic
1180487907 22:15818563-15818585 TCGCTCCATAGCTCCAGGCCAGG + Intergenic
1182890374 22:33813206-33813228 TCGTGCCATCACTCCAGCCTGGG + Intronic
1183441527 22:37825542-37825564 TCGTGGCATTGCCCCATCCCTGG - Intergenic
949380369 3:3438395-3438417 TCTTAACCTTGCACCAGCCCCGG - Intergenic
951007530 3:17635633-17635655 TCATGCCACTGCTCCAGCCTGGG + Intronic
951649769 3:24938129-24938151 TCTTACCATTGGCCCAGCCAAGG - Intergenic
954939217 3:54355710-54355732 TCCTACCTTTACTCCTGCCCTGG - Intronic
955723502 3:61908074-61908096 TTGTGCCACTGCTCCAGCCTGGG + Intronic
956417036 3:69043212-69043234 TTGTACCACTACTCCAGCCTGGG - Intronic
960521657 3:118662256-118662278 CCTGACCATTGCTCCAGCGCTGG + Intergenic
961815421 3:129547708-129547730 CAGGACCATTGCTCCAACCCTGG - Intronic
963186519 3:142424136-142424158 TCGCGCCACTGCTCCAGCCTGGG - Intronic
963611831 3:147478043-147478065 TCACACCATTGCTCCAGCCTGGG + Intronic
963793795 3:149611107-149611129 TTGCACCACTGCTCCAGCCTGGG + Intronic
967159833 3:186725973-186725995 TCGCGCCACTGCTCCAGCCTAGG - Intronic
968165792 3:196464241-196464263 TGGCACCACTGCTCCAGCCCGGG - Intergenic
968822378 4:2864370-2864392 GCGTGCCATTGCTCCACCCTGGG + Intronic
969112788 4:4854068-4854090 TCGCTCCACTGCTCCAGCCTAGG - Intergenic
969174546 4:5388574-5388596 TACTACCATGGCTCCAGCCTTGG + Intronic
971091809 4:23354250-23354272 TCATGCCACTGCTCCAGCCTGGG - Intergenic
972563548 4:40249652-40249674 TCATGCCATTACTCCAGCCTGGG + Intergenic
972581406 4:40398716-40398738 TCGTGCCACTGCACCAGCCTGGG - Intergenic
972892274 4:43573465-43573487 TTGTAGGATTGCTCGAGCCCAGG + Intergenic
973983072 4:56322982-56323004 TTGCACCACTGCTCCAGCCTGGG + Intronic
980307417 4:131080718-131080740 TGGGAGGATTGCTCCAGCCCAGG + Intergenic
983134674 4:164065831-164065853 TCCTTCCATTTCTCCTGCCCTGG - Intronic
983619551 4:169745728-169745750 TGGGAGCATTGCTCGAGCCCAGG - Intronic
984631337 4:182064536-182064558 TCGCACCACTGCTCCAGCCTGGG + Intergenic
986590582 5:9365222-9365244 CCTTGCCCTTGCTCCAGCCCTGG - Intronic
991170501 5:63619560-63619582 TCGTGCCATTTCTCCAGCCTGGG - Intergenic
991302079 5:65138807-65138829 TTGCACCATTGTTCCAGCCTGGG - Intergenic
992759999 5:79943142-79943164 TCGTGCCACTGCTCCAGTCTGGG - Intergenic
993913945 5:93718392-93718414 TTGTGCCACTGCTCCAGCCTGGG + Intronic
994948269 5:106423928-106423950 TTGAACCATTCCTGCAGCCCTGG + Intergenic
995053347 5:107731443-107731465 TTGCACCACTGCTCCAGCCTGGG - Intergenic
997921388 5:137982475-137982497 TTGTGCCACTGCTCCAGCCTGGG + Intronic
999176685 5:149636702-149636724 TCTTTCCTTTGCCCCAGCCCAGG - Intergenic
1001046326 5:168374816-168374838 CCTGACCATTGCTACAGCCCAGG - Intronic
1004546666 6:16604404-16604426 TAGGACCATTGCTTGAGCCCAGG + Intronic
1005310704 6:24556271-24556293 TGGGACAATTGCTTCAGCCCAGG - Intronic
1006758526 6:36439041-36439063 TCGCACCACTGCTCCAACCTGGG - Intronic
1007670494 6:43549104-43549126 TCACGCCATTGCTCCAGCCTGGG - Intronic
1010372183 6:75123333-75123355 TCCCACCATTCCACCAGCCCGGG - Exonic
1011556005 6:88572233-88572255 TGGTAGCATTGCTCCAGCAAAGG + Intergenic
1011644166 6:89442039-89442061 TCATGCCACTGCTCCAGCCTGGG - Intronic
1013496714 6:110705083-110705105 TTGTGCCATTGCTCCAGCCTGGG - Intronic
1015646034 6:135389264-135389286 TCGTGCCACTGCACCAGCCTGGG + Intronic
1020160510 7:5767641-5767663 TCGCACCATTACTTCAGCCTGGG - Intronic
1021345646 7:19525029-19525051 TCGTACCATTGCACCAGCCTGGG - Intergenic
1025962176 7:66232245-66232267 TCACACCATAGCTCCAGCCTGGG - Intronic
1026348358 7:69494479-69494501 TCGTGCCACTGCTCCAGCCTGGG - Intergenic
1026748903 7:73034329-73034351 TGGTAGCATTGCTTGAGCCCAGG + Intergenic
1026752551 7:73062474-73062496 TGGTAGCATTGCTTGAGCCCAGG + Intergenic
1026756202 7:73090605-73090627 TGGTAGCATTGCTTGAGCCCAGG + Intergenic
1027023910 7:74836923-74836945 TCGTGCCATTGCACCAGCCTGGG - Intronic
1027035100 7:74919624-74919646 TGGTAGCATTGCTTGAGCCCAGG + Intergenic
1027064020 7:75108398-75108420 TCGTGCCATTGCACCAGCCTGGG + Intronic
1027091203 7:75302819-75302841 TGGTAGCATTGCTTGAGCCCAGG - Intergenic
1027094848 7:75330792-75330814 TGGTAGCATTGCTTGAGCCCAGG - Intergenic
1027195602 7:76028012-76028034 GCGTAGGATTGCTCGAGCCCAGG + Intronic
1027324492 7:77036893-77036915 TGGTAGCATTGCTTGAGCCCAGG + Intergenic
1027868459 7:83675742-83675764 TCGCGCCACTGCTCCAGCCTGGG + Intergenic
1028231967 7:88316412-88316434 TTGTGCCACTGCTCCAGCCTGGG + Intergenic
1028980852 7:96966833-96966855 TCATGCCATTACTCCAGCCTGGG - Intergenic
1029213495 7:98928191-98928213 TCGTGCCATTGTTCCAGCCTGGG + Intronic
1029292215 7:99510783-99510805 TTGCACCAATGCTCCAGCCTGGG - Intronic
1029394957 7:100301515-100301537 TGGTAGCATTGCTTGAGCCCAGG - Intergenic
1029871211 7:103694750-103694772 TGGGACCATTGCTTGAGCCCAGG - Intronic
1031902438 7:127426434-127426456 TCGCACCACTGCTCCAGCCTAGG - Intronic
1032460251 7:132104887-132104909 TCCTACCATGGGTCCAGGCCTGG - Intergenic
1033380732 7:140815476-140815498 TCGCACCATTGCACAAGCCTGGG - Intronic
1036657823 8:10689106-10689128 TCTTTTCATTGCCCCAGCCCTGG - Intronic
1036774029 8:11597724-11597746 TGCTCCCATTGCTCCCGCCCTGG - Intergenic
1037862930 8:22418934-22418956 TGGGACAATTGCTCGAGCCCAGG + Intronic
1038567062 8:28628485-28628507 TTGCACCACTGCTCCAGCCTGGG + Intronic
1038634273 8:29272781-29272803 TAGGAGGATTGCTCCAGCCCAGG + Intergenic
1039091104 8:33830646-33830668 TCACACCACTGCTCCAGCCTGGG + Intergenic
1039516299 8:38136728-38136750 TCGTGCCACTACTCCAGCCTGGG + Intronic
1039629107 8:39089202-39089224 TCGTGCCATTGCACTAGCCTGGG + Intronic
1040507452 8:48062543-48062565 GCGCACCACTGCTCCAGCCTGGG + Exonic
1042530267 8:69807746-69807768 TCGCACCACTGCTCCAGCCTGGG - Intronic
1044237185 8:89844276-89844298 TCGTGCCACTGCCCCAGCCTGGG + Intergenic
1046537925 8:115539811-115539833 TCCTGCCACTGCTCCAGCCTGGG + Intronic
1047098911 8:121655545-121655567 TTGTGCCACTGCTCCAGCCTGGG - Intergenic
1049633727 8:143674158-143674180 TCCCACCATTGCCCCCGCCCAGG - Intergenic
1051666383 9:19470484-19470506 ACGCACCATTGTTCCAACCCTGG - Intergenic
1052920477 9:33962599-33962621 TCATGCCACTGCTCCAGCCTGGG + Intronic
1053258143 9:36636877-36636899 TCGTGCCACTGCTCCAGCCTGGG - Intronic
1056153488 9:83812390-83812412 TCACACCACTGCTCCAGCCTTGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056191558 9:84189152-84189174 TCGGACAATTGCTTGAGCCCAGG + Intergenic
1056357001 9:85810700-85810722 TCACACCACTGCTCCAGCCTTGG + Intergenic
1056782280 9:89559750-89559772 CCCTCCCATTGCTCCAGTCCTGG - Intergenic
1057623458 9:96656362-96656384 TCGTGCCAATGCTCCAGCCTGGG - Intergenic
1059083509 9:111274998-111275020 TGGGATAATTGCTCCAGCCCTGG - Intergenic
1061194267 9:129099017-129099039 TCGTTCCATTGCTCCAGCCTGGG - Intronic
1061432065 9:130537314-130537336 CCGAACCAGTGCTCCTGCCCGGG + Intergenic
1187263538 X:17709651-17709673 TCCTTCCATTCCTCCAGCCCTGG - Intronic
1187904927 X:24056764-24056786 TCGGAGGATTGCTCAAGCCCAGG + Intronic
1190307103 X:49090580-49090602 TCGTGCCATTGCTCCAGCCTGGG - Intronic
1192411136 X:70933627-70933649 TCGCACCACTGCACCAGCCTGGG - Intergenic
1195121830 X:101762259-101762281 TCTGACCATTTCTCAAGCCCTGG + Intergenic
1195236693 X:102906375-102906397 TCTGACCATTTCTCAAGCCCTGG - Intergenic
1195248118 X:103015222-103015244 TCTGACCATTTCTCAAGCCCTGG - Intergenic
1195265426 X:103174920-103174942 TCTGACCATTTCTCAAGCCCTGG - Intergenic
1195296861 X:103487089-103487111 TCTGACCATTTCTCAAGCCCTGG - Intergenic
1195298923 X:103508257-103508279 TCTGACCATTTCTCAAGCCCTGG + Intronic
1198476783 X:137002047-137002069 TCATAACATTGCCTCAGCCCTGG - Intergenic
1198938357 X:141924051-141924073 TCGCACCACTTCTCCAGGCCTGG - Intergenic
1199273914 X:145920723-145920745 CTGTACCCTTGCCCCAGCCCAGG + Intergenic
1200155679 X:153973636-153973658 TCGCGCCACTGCTCCAGCCTGGG + Intronic
1201399856 Y:13593622-13593644 TCTTACCAGTTCTCCAGCACAGG + Intergenic