ID: 1158568632

View in Genome Browser
Species Human (GRCh38)
Location 18:58577231-58577253
Sequence TGCCCCAAATTTCAAAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158568632_1158568635 13 Left 1158568632 18:58577231-58577253 CCAGCTCTTTGAAATTTGGGGCA 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1158568635 18:58577267-58577289 GCAATTGCCTTCCACAATGGTGG 0: 1
1: 0
2: 0
3: 8
4: 196
1158568632_1158568634 10 Left 1158568632 18:58577231-58577253 CCAGCTCTTTGAAATTTGGGGCA 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1158568634 18:58577264-58577286 ACAGCAATTGCCTTCCACAATGG 0: 1
1: 0
2: 1
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158568632 Original CRISPR TGCCCCAAATTTCAAAGAGC TGG (reversed) Intronic
901024018 1:6269649-6269671 TGCTGCAAATATTAAAGAGCAGG - Intronic
901159529 1:7164275-7164297 TGCCTCAACTTCCAAATAGCTGG - Intronic
901962940 1:12841563-12841585 TGTCCCAACTTCTAAAGAGCAGG + Intergenic
901990131 1:13105869-13105891 TGTCCCAACTTCTAAAGAGCAGG + Intergenic
902218032 1:14946982-14947004 TGCCCCACACCTCACAGAGCAGG - Intronic
907018747 1:51044143-51044165 TGCCTCAGCCTTCAAAGAGCTGG + Intergenic
910739938 1:90504161-90504183 TGCCCCAAATTTGAGAGAAGGGG - Intergenic
912947393 1:114096421-114096443 TGCCCCAAAGGTCACAGGGCAGG + Intronic
913404566 1:118475345-118475367 TGCCCCAAGTTTTGAAGATCAGG + Intergenic
914198486 1:145463643-145463665 TCCCCCAAAATTCAAAGACTAGG - Intergenic
914477592 1:148036772-148036794 TCCCCCAAAATTCAAAGACTAGG - Intergenic
915308557 1:154995038-154995060 TGCCCCAAGTGACAAAGGGCTGG - Intergenic
917028969 1:170669026-170669048 TTCCCCAAAATTCTAAGAGAAGG - Intronic
917813862 1:178687642-178687664 TGCACCAATATTCAAAAAGCAGG + Intergenic
918581776 1:186139394-186139416 TGTTCTAAATTTAAAAGAGCAGG + Intronic
920702478 1:208228346-208228368 TTCCCAAAAGTTCAAAGGGCGGG + Intronic
1063724944 10:8626619-8626641 TGCCCCAAATTTCTATTAGTAGG - Intergenic
1064640812 10:17414162-17414184 AGCCCCAAATGGCAAAGAGTTGG - Intronic
1065110907 10:22438602-22438624 TGCTCCAAAACACAAAGAGCAGG - Intronic
1069746799 10:70720229-70720251 TGCCCTATATTTTAAAGGGCTGG - Intronic
1069829382 10:71273248-71273270 TACCCCAAAGTTGACAGAGCAGG + Intronic
1069898032 10:71690836-71690858 TGCTCCATCTTACAAAGAGCTGG + Intronic
1069988232 10:72298382-72298404 TGCCCAAAATTTATAAGAGAAGG + Intergenic
1070410418 10:76134247-76134269 TGCCCCAATTTCCCAAAAGCTGG - Intronic
1072019314 10:91382674-91382696 GGCCCCAAACTGCACAGAGCAGG + Intergenic
1073447146 10:103588520-103588542 AGCCCCTGACTTCAAAGAGCTGG - Intronic
1073517749 10:104092719-104092741 TAACACAAATTTCAAAGAACTGG - Intergenic
1074752134 10:116596694-116596716 TGCCCTTGATTTCAAAGAGAAGG - Intronic
1075206421 10:120453221-120453243 TGCCCCAAATCACAAAAAGCAGG - Intergenic
1080481300 11:32652735-32652757 TACCCCAAACTTCTGAGAGCTGG + Intronic
1083194169 11:61073038-61073060 TGCCCCAAATTCCAGAGGCCAGG + Intergenic
1086195183 11:84129429-84129451 TCCCCCAAATTTCAATGCCCAGG + Intronic
1086500162 11:87444619-87444641 TTCCCCAAAATTAAAAGAGAGGG - Intergenic
1086823782 11:91470245-91470267 TGCAGGAAATTTCAAAGAACAGG - Intergenic
1086868262 11:92006552-92006574 TGCCTAGAATTTCAAAAAGCAGG + Intergenic
1086972159 11:93093929-93093951 TGCCACAAACCTCAAAGAGTGGG - Intergenic
1087826095 11:102766495-102766517 TGACCCAAAATCCAAAGAGAAGG - Intergenic
1089156983 11:116410102-116410124 AGCCCCAAATTTCAACGAAGGGG + Intergenic
1089309478 11:117548311-117548333 TGCCCCAAATCTCAAAGCTGGGG + Intronic
1090456824 11:126857331-126857353 TGCCCCAACTTGCAGAGAACAGG + Intronic
1091842125 12:3628717-3628739 TGCCCTAAAGTTCTAAGATCTGG - Intronic
1092483623 12:8882662-8882684 TGGCCCAGATTTTAAATAGCTGG - Intronic
1093663812 12:21788499-21788521 TGGCCTAGATATCAAAGAGCTGG + Intergenic
1093783870 12:23170197-23170219 TGCCTCAAATTGCAAAGTGTGGG + Intergenic
1093915931 12:24802605-24802627 GGCCTCAAGTTTCAAAGTGCTGG + Intergenic
1095621775 12:44264935-44264957 TGCCCCAAAAGTGACAGAGCTGG + Intronic
1105212208 13:18263590-18263612 TGGCACAAGTTTCCAAGAGCTGG + Intergenic
1105228963 13:18470987-18471009 TGCCTCAAACTCCAAAGTGCTGG - Intergenic
1109493425 13:63133703-63133725 TACCCCTAATTTCAAAGTCCTGG + Intergenic
1112755924 13:102633350-102633372 TACACCAAATTTCAAAGACTTGG + Intronic
1113166366 13:107447987-107448009 TGCCCTGTATTTGAAAGAGCAGG - Intronic
1114013253 14:18397975-18397997 TGCCTCAAACTCCAAAGTGCTGG - Intergenic
1117967292 14:61218989-61219011 TGCCCCTAATTCAAAACAGCTGG - Intronic
1119193847 14:72702571-72702593 GGCCCCAAACTTCTACGAGCCGG - Intronic
1120454315 14:84712882-84712904 TGCCACAAATTTCAATTAGTAGG - Intergenic
1123430252 15:20208826-20208848 AGCCTCAAATTTCAAAGTTCAGG - Intergenic
1123451340 15:20363490-20363512 TTCTCCAAATTTTAAAGAACAGG + Intergenic
1123903490 15:24899363-24899385 TGACTCAATTTTCACAGAGCAGG - Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124129676 15:26972486-26972508 TGCTCCAATTTTCAAATAACAGG - Intronic
1125401062 15:39303759-39303781 TGCCCCAAATCTCCAAGTGCTGG - Intergenic
1131639605 15:94277592-94277614 TTCCCAGAATGTCAAAGAGCTGG - Intronic
1134029458 16:10980157-10980179 CGCCCCAAATTCAAAACAGCTGG - Intronic
1136854385 16:33642383-33642405 AGCCTCAAATTTCAAAGTTCAGG + Intergenic
1139304264 16:65969727-65969749 AGCCCCAAACATCACAGAGCTGG + Intergenic
1203115963 16_KI270728v1_random:1490833-1490855 AGCCTCAAATTTCAAAGTTCAGG + Intergenic
1144057642 17:11556844-11556866 TGCCCCAAATTTCAGAAATGAGG - Intronic
1146852662 17:36236755-36236777 TTCCCCAAATTTCCAAAAACTGG - Intronic
1146868572 17:36360634-36360656 TTCCCCAAATTTCCAAAAACTGG - Intronic
1147071447 17:37961258-37961280 TTCCCCAAATTTCCAAAAACTGG - Intergenic
1147082974 17:38040784-38040806 TTCCCCAAATTTCCAAAAACTGG - Intronic
1147098917 17:38164755-38164777 TTCCCCAAATTTCCAAAAACTGG - Intergenic
1148330848 17:46813102-46813124 TGACCTAAATCGCAAAGAGCTGG - Intronic
1149308031 17:55368224-55368246 TACCCCAGATTTCAAACATCTGG - Intergenic
1150080453 17:62233795-62233817 TTCCCCAAATTTCCAAAAACTGG - Intergenic
1152276312 17:79359711-79359733 TGACCCAAATTACGAAGTGCAGG - Intronic
1156682863 18:39612027-39612049 GGCCCCAAAGTTCAAATACCAGG + Intergenic
1156981414 18:43292755-43292777 TGCCAAAAATTAGAAAGAGCTGG + Intergenic
1157773805 18:50374786-50374808 TGCAGCAAATGTCAAAGACCAGG + Intergenic
1157980301 18:52372145-52372167 TGCCTCCAACTACAAAGAGCTGG + Intronic
1158032133 18:52978860-52978882 TGCAGCAAATTGCATAGAGCTGG - Intronic
1158568632 18:58577231-58577253 TGCCCCAAATTTCAAAGAGCTGG - Intronic
1158743589 18:60171189-60171211 TAGTCCAAATTTCAAAGGGCTGG + Intergenic
1158983740 18:62792212-62792234 TGTCCCATCTTTCAAACAGCTGG + Intronic
1159999843 18:75006632-75006654 TACAACAAATTTCAAAGAACTGG - Intronic
1160113684 18:76057545-76057567 TTCCCCAAATGACACAGAGCGGG + Intergenic
1164533986 19:29070778-29070800 TGCCCAGAATGTCATAGAGCTGG - Intergenic
1164930161 19:32169129-32169151 GGCCCCAAGTTTCAGAAAGCTGG + Intergenic
1166561116 19:43732996-43733018 TGCCCCAACTTTCCAGGACCTGG - Exonic
1168144207 19:54410635-54410657 TGTTCCAAATTTCCAAGAGAAGG - Intergenic
925784826 2:7421783-7421805 TGTCCCAAATTGAAAAGAGATGG - Intergenic
926485637 2:13452794-13452816 TTCTCCAAATTTTAAAGAACAGG - Intergenic
928431254 2:31220160-31220182 TGCCCCAAATTCCAACAATCAGG - Intronic
933153892 2:78948899-78948921 TGCTCCAAATTTCAAAGAGTAGG + Intergenic
934301415 2:91778812-91778834 TGGCACAAGTTTCCAAGAGCTGG - Intergenic
934606867 2:95702021-95702043 TGCCCCAATTTTTAAAAATCTGG + Intergenic
935884415 2:107600275-107600297 TACCCTAAATTTAAAAGAGATGG - Intergenic
939547744 2:143574250-143574272 TGCCTCAGATTTCTAAGAGGTGG + Intronic
943861429 2:192869068-192869090 AGCCCTTAATTTCAAATAGCTGG + Intergenic
945619185 2:212111958-212111980 TGCCATGAATTTCAAAGAGTTGG + Intronic
946130827 2:217605359-217605381 TGCCCCAAATGGCAGAGAGCAGG - Intronic
946971491 2:225097258-225097280 AGCCCCAAATTGGAAACAGCTGG - Intergenic
948275276 2:236703672-236703694 TGCCCCAAGTTTGTAAGAGTTGG - Intergenic
948313106 2:237004512-237004534 TCCCCCAACTTTCAAAGGGCTGG - Intergenic
1170914358 20:20608287-20608309 TGGCTCATATTACAAAGAGCAGG + Intronic
1174473848 20:50781936-50781958 CTTCCCAAATTTCAATGAGCCGG - Intergenic
1175224005 20:57434239-57434261 GGCCCCAAATGTCAAAGGGGTGG + Intergenic
1175416807 20:58806730-58806752 GACCCCAAATTTCAGCGAGCAGG + Intergenic
1176772954 21:13099346-13099368 TGCCTCAAACTCCAAAGTGCTGG - Intergenic
1179790745 21:43754653-43754675 TGCCCCACATTCCAAAGGGATGG - Intronic
1180437750 22:15328788-15328810 TGCCTCAAACTCCAAAGTGCTGG - Intergenic
1180815022 22:18783910-18783932 TGGCACAAGTTTCCAAGAGCTGG + Intergenic
1181201210 22:21218247-21218269 TGGCACAAGTTTCCAAGAGCTGG + Intronic
1181543991 22:23590577-23590599 GTCCCCAAATATCAAAGGGCTGG - Intergenic
1181700533 22:24618720-24618742 TGGCACAAGTTTCCAAGAGCTGG - Intronic
1182448165 22:30401979-30402001 TTCCAGAAATTTCACAGAGCTGG + Intronic
1182860165 22:33553010-33553032 TGCTCCTAATTGGAAAGAGCTGG - Intronic
1203225703 22_KI270731v1_random:77184-77206 TGGCACAAGTTTCCAAGAGCTGG - Intergenic
1203265125 22_KI270734v1_random:9600-9622 TGGCACAAGTTTCCAAGAGCTGG + Intergenic
950152008 3:10695001-10695023 TCACCCAAAATTCAAAGAGTGGG - Intronic
953608916 3:44431172-44431194 TGCTACAAATTTCATAGAGCTGG + Intergenic
954907205 3:54072872-54072894 TGCTTCAAATGTGAAAGAGCAGG + Intergenic
954966856 3:54619619-54619641 TCCCCCAAATTGCAAACAGCTGG + Intronic
956862591 3:73339318-73339340 TGCCCTAAATGTCAATCAGCCGG - Intergenic
959552648 3:107680371-107680393 AGCCCCATATTTCTAAGAGGAGG + Intronic
959924307 3:111904504-111904526 TGCCCCAGATTGCAAAGCTCTGG + Intronic
961417957 3:126775141-126775163 TGACCTAAATTTCAAAGATTTGG + Intronic
961509840 3:127394092-127394114 GGCCCCAAATCTCAAAGCCCAGG + Intergenic
963149212 3:142026578-142026600 TGCCTCATATGTGAAAGAGCTGG + Intronic
964447736 3:156777928-156777950 TACCCCAAATTTCAGATATCAGG - Intergenic
965566308 3:170122133-170122155 TGCCCCAGCTTCCAAATAGCTGG - Intronic
970776207 4:19677396-19677418 TTCCCCAAATCCCAAAGTGCAGG + Intergenic
972502038 4:39687106-39687128 TGCTCCAAATTACAATGATCAGG - Intergenic
972739836 4:41878895-41878917 TGTCCCAAAATAGAAAGAGCTGG - Intergenic
973148925 4:46864010-46864032 TGACCTAAATTCCAAATAGCGGG - Intronic
973863669 4:55090576-55090598 TTCCCCTGATTTCAAAGTGCTGG + Intronic
976971950 4:91114625-91114647 TGCCACCAACTGCAAAGAGCAGG - Intronic
978266036 4:106825610-106825632 TTCGCCAAATTTCAAAGAAATGG + Intergenic
983501112 4:168500712-168500734 TCTCCCAAATATCATAGAGCTGG + Intronic
987454676 5:18128851-18128873 GGCCTCAAATTTCAAAGGACAGG - Intergenic
987794156 5:22606183-22606205 TGTCCCTAAATTCAAAGATCTGG - Intronic
989529958 5:42496534-42496556 TGCCCCAACTTTCAGAAATCAGG - Intronic
989645940 5:43632701-43632723 AGCCCCAAAGGTCAACGAGCTGG - Intronic
990208258 5:53453539-53453561 GACCTTAAATTTCAAAGAGCAGG + Intergenic
990885843 5:60592681-60592703 TGCTCCTAATTTCAAAGAGGAGG - Intergenic
991047486 5:62237798-62237820 AGCCTCAAATTTCAAAGTTCAGG - Intergenic
993799309 5:92311795-92311817 TGTCCCAACTTTGAAAGAGTTGG - Intergenic
994282103 5:97917434-97917456 AGCCCCATATTTTAAAGAGAAGG + Intergenic
994926408 5:106121958-106121980 TGCCCCAAATTCCAACCAGCTGG - Intergenic
998899395 5:146836445-146836467 TGTCCCAAATTGCAACGAACTGG + Intronic
1001445932 5:171783119-171783141 TGCCAAAAATTACAAAGTGCTGG + Intergenic
1001798983 5:174527008-174527030 TGCACCAGACTTCCAAGAGCTGG + Intergenic
1001884753 5:175279289-175279311 TGCCCCAAATGGCAAAGGGAGGG - Intergenic
1002761448 6:205612-205634 TACCTCAAATTTCAAAGGCCAGG - Intergenic
1002940992 6:1715933-1715955 TTCCCCAAAATTCAAACAGCAGG + Intronic
1006282970 6:33070133-33070155 TGCCCAGACTTTCAAAGACCAGG - Intronic
1010939022 6:81893834-81893856 TTCACCAAAGTTCATAGAGCAGG + Intergenic
1011888664 6:92128973-92128995 TGCCCCATACTTCAAATAGAAGG + Intergenic
1013977130 6:116091767-116091789 TGCTCCCAACTCCAAAGAGCCGG - Intergenic
1018753774 6:166830854-166830876 TGTCCCAAATCTCAAAGAAAAGG - Intronic
1020477112 7:8609441-8609463 TGCCTCAAATATCAAGAAGCTGG + Intronic
1021343955 7:19499373-19499395 TTCCCCAAATTTCATAAGGCTGG - Intergenic
1021600985 7:22362905-22362927 TGCCCCAAATTCCATACAACTGG - Intergenic
1025982560 7:66418753-66418775 TGCCCTACACTTCCAAGAGCAGG + Intronic
1029744772 7:102510808-102510830 TTCCCCAAATGTAAAACAGCTGG - Intronic
1029762764 7:102609970-102609992 TTCCCCAAATGTAAAACAGCTGG - Intronic
1030196070 7:106855042-106855064 TACCCCTAATTTCAAAGGGTGGG + Intergenic
1031507335 7:122601806-122601828 TTCTTCAAATTTCAAAGAGAAGG + Intronic
1031956654 7:127949380-127949402 TGAGCCAAGTTTAAAAGAGCTGG + Intronic
1032252872 7:130272858-130272880 TGCACAAAACTGCAAAGAGCCGG + Intronic
1032378853 7:131454505-131454527 TGTCCCAACTTTCAAAGAGAAGG + Intronic
1033441810 7:141386939-141386961 TGCCCCAAATTTCAAAATCCCGG + Intronic
1040828299 8:51647573-51647595 TTCCCCAAATCACAAAGAGATGG + Intronic
1044271007 8:90243883-90243905 TGACTCAAATTACAAAGTGCTGG + Intergenic
1047020357 8:120769134-120769156 TGCCCTGAATTTCAAATAGAGGG - Intronic
1047660309 8:127026560-127026582 AGCAGCAAATTTCGAAGAGCTGG + Intergenic
1051293084 9:15565303-15565325 TTCCCCAAAATTGAAAAAGCAGG - Intronic
1052903606 9:33816446-33816468 TGCCCCAAATCACAATGAGAAGG + Intergenic
1057894583 9:98898463-98898485 TACCTCAATTTTCAAAGAGAAGG + Intergenic
1059660531 9:116395740-116395762 TGCACCAAATTTGAAGGACCTGG - Intronic
1061528804 9:131193529-131193551 TGCAGCAAATTTTAAAGAGTAGG + Intronic
1062635892 9:137491526-137491548 TCCCCCAAAATTCACAGTGCAGG + Intronic
1189076011 X:37915301-37915323 TGGCCCAAAATTCAAAAATCTGG - Intronic
1189684951 X:43554287-43554309 TGCCCAATAGTTGAAAGAGCTGG - Intergenic
1189748551 X:44195129-44195151 TGACCCCATTGTCAAAGAGCAGG - Intronic
1189960622 X:46321517-46321539 TGCCCAAGATTTCAAACATCTGG + Intergenic
1192428311 X:71096217-71096239 TGCCTCAGGTTTAAAAGAGCAGG + Exonic
1192446689 X:71216200-71216222 TGCAACAACTTTCAAACAGCTGG - Intronic
1194078943 X:89433426-89433448 TGCCCCAAAGTTCTTAGATCTGG - Intergenic
1197666560 X:129230214-129230236 GGCCCAAATTTTCAAAGAGTAGG + Intergenic
1200431566 Y:3088748-3088770 TGCCCCAAAGTTCTTAGATCTGG - Intergenic
1200979159 Y:9245951-9245973 TTCCCTAAATTTCAAAAAGGTGG - Intergenic
1202132207 Y:21623191-21623213 TTCCCTAAATTTCAAAAAGGTGG + Intergenic